header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-8589
Transcript Name: prpf8-201
Previous Name: prpf8-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000025885 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000025885|OTTDARG00000020633|ZDB-GENE-030131-577 prpf8|OTTDARP00000021268 prpf8-001 LG_ CR522882.5 Danio rerio protein_coding KNOWN, 7534 bp
AGATACGTAAGCGCTTTGGAGAATGGAAAGACTCTACGCA
CAACGTGCATAGTACGCCATTCCGCTGAGCACAAAACCAC
CGTACAACTACAGTCACTGGCGAGAAACTGCTTTTAACTT
AGACGCTGCCATGGCAGCTCCTTTCCCCTACAGAGGTCTT
CCTGGACCAATGCCTCCAGGTGTTCCTCCACCTCCTCCTG
CTGTTGCTCCAGTGCCAGATTATATGACTGAGGAGAAACT
GCAAGAGAAAGCTCGTAAATGGCAGCAGCTGCAGGCCAAG
CGCTACTCTGAGAAAAGGAAATTTGGCTTCGTGGATGCTC
AGAAAGAGGACATGCCACCAGAACATGTGCGCAAAATTAT
CAGGGATCATGGTGACATGACGAACAGGAAATTTCGTCAT
GATAAAAGAGTCTACCTAGGGGCCCTGAAGTATATGCCCC
ATGCAGTGCTCAAACTGCTGGAGAACATGCCAATGCCCTG
GGAGCAGATCAGAGATGTACCTGTGCTCTACCACATCACA
GGCGCTATATCTTTCGTGAATGAAATCCCTTGGGTTATTG
AGCCAGTGTACATTTCTCAGTGGGGCACAATGTGGATCAT
GATGCGTCGTGAGAAGAGAGACAGACGGCACTTCAAGCGC
ATGCGTTTCCCGCCATTTGATGATGAAGAGCCTCCTTTGG
ATTATGCAGACAACATCCTGGATGTGGAGCCTCTGGAGGC
GATCCAGATGGAGCTGGACCCTGATGAGGACTCTTCTGTC
ACAGACTGGCTCTATGAGCATCAACCTCTGAAAGACACCA
CCAAATACGTGAATGGGACCACATACAGACGATGGCAATT
CACTTTGCCAATGATGTCCACTCTGTATCGATTGGCTAAT
CAGCTGCTGACAGACTTGGTGGATGACAATTACTTTTACT
TGTTTGACTTGAAAGCTTTCTTCACCTCTAAAGCTTTGAA
CATGGCCATTCCTGGAGGACCTAAATTTGAGCCACTTGTC
AGAGACATTAACCTCCAGGATGAAGACTGGAATGAGTTCA
ATGACATCAACAAGATCATCATCAGACAGCCAATCAGGAC
AGAATACAAAATTGCATTCCCTTACTTGTACAACAATCTG
CCACATCATGTGCACCTCACCTGGTACCATACACCAAATG
TGGTGTTCATCAAGACTGAAGATCCTGATCTACCCGCCTT
CTACTTTGACCCTCTGATCAACCCCATCTCTCATAGGCAC
TCAGTCAAGAGCCAAGAGCCACTGCCAGATGATGATGAGG
AGTTTGAACTTCCTGAGTATGTAGAGCCGTTCCTGAAGGA
GACGCCGCTTTACACTGACAACACTGCTAATGGAATCGCT
CTGTTGTGGGCACCTCGTCCATTCAATCTCCGCTCTGGAA
GAACCAGACGAGCCATTGATGTTCCTCTCGTCAAAAACTG
GTATCGTGAGCACTGTCCTGCAGGCCAGCCTGTGAAGGTG
CGTGTGTCTTACCAGAAGCTTCTGAAGTACTATGTGTTGA
ATGCTCTAAAACACAGACCACCAAAGGCACAGAAAAAGAG
ATACCTGTTCCGCTCTTTCAAGGCCACCAAATTCTTCCAG
TCAACAAAGCTGGACTGGGTAGAAGTCGGACTCCAGGTGT
GCCGGCAGGGCTACAACATGCTGAACCTGCTGATTCACAG
AAAGAACCTGAACTACCTGCACTTGGACTACAACTTCAAC
TTGAAGCCTGTAAAAACCCTCACAACAAAGGAACGTAAGA
AGTCTAGATTCGGAAATGCGTTTCACTTGTGCCGTGAGGT
TCTGCGCTTGAGCAAGCTGGTGGTGGACAGTCATGTACAG
TACAGGCTTGGAAATGTTGATGCTTTCCAGCTTGCTGATG
GCTTGCAGTACATCTTTGCCCATGTGGGTCAACTGACTGG
CATGTACCGCTACAAGTACAAGCTCATGAGGCAGATCAGA
ATGTGCAAAGACCTGAAGCATCTCATCTACTATCGCTTCA
ACACAGGCCCAGTTGGAAAAGGTCCAGGCTGTGGGTTCTG
GGCACCAGGATGGAGAGTCTGGCTGTTCTTCATGAGAGGC
ATTACCCCTCTTTTGGAGCGGTGGCTCGGCAATCTTCTGG
CTAGGCAGTTTGAGGGTCGACACTCTAAGGGTGTTGCCAA
GACTGTGACCAAACAGCGTGTGGAATCTCACTTTGATCTG
GAGCTGAGAGCTGCTGTGATGCATGACATCCTGGATATGA
TGCCTGAGGGTATCAAGCAAAACAAGGCCAGAACCATCTT
GCAGCACCTCAGTGAGTCATGGAGATGCTGGAAGGCCAAC
ATTCCTTGGAAGGTTCCTGGGCTTCCAACTCCCATCGAGA
ACATGATTCTTCGTTACGTGAAGGCTAAAGCTGACTGGTG
GACCAACACGGCTCACTACAACCGTGAGAGAATCAGAAGA
GGAGCAACTGTGGATAAGACTGTGTGCAAGAAGAACTTGG
GACGTCTCACTCGACTCTACCTAAAAGCAGAGCAGGAGAG
ACAGCACAATTACCTGAAGGATGGGCCTTACATCACAGCT
GAGGAGGCCGTGGCCATCTACACCACCACAGTGCACTGGC
TGGAGAGTCGTCGGTTCTCTCCGATTCCCTTCCCTCCTCT
CTCCTACAAGCATGACACCAAGCTGCTCATTCTGGCGTTG
GAGAGACTCAAGGAAGCTTACAGTGTGAAGTCTAGGCTGA
ACCAGTCACAGCGTGAGGAGTTGGGTCTGATTGAGCAGGC
CTATGACAACCCTCATGAGGCTCTGTCCAGAATCAAACGT
CACCTCCTCACTCAGAGAGCCTTCAAAGAGGTTGGCATTG
AGTTCATGGACCTTTACAGTCACTTGGTGCCGGTTTATGA
TGTTGAACCTTTGGAAAAGATCACTGACGCATACCTGGAT
CAGTACCTGTGGTACGAGGCAGACAAACGTAGGCTTTTCC
CACCCTGGATCAAACCAGCTGACACAGAGCCACCACCACT
GCTGGTGTACAAATGGTGCCAAGGAATCAACAACTTGCAG
GATGTATGGGAGACAGCAGAGGGTGAATGTAATGTTATGC
TGGAGTCTCGCTACGAGAAGATGTATGAGAAGATTGATCT
GACGCTGCTGAACAGGCTTCTGCGTCTCATTGTTGATCAC
AACATTGCTGATTACATGACAGCTAAAAACAACGTTGTCA
TTAACTATAAGGACATGAACCATACAAACTCGTACGGTAT
CATTCGTGGCCTGCAGTTTGCCTCTTTCATTGTGCAGTAC
TATGGACTTGTGATGGACCTGCTGGTGCTGGGTCTGCACA
GAGCCAGTGAGATGGCAGGACCTCCTCAGATGCCTAATGA
TTTCCTCAGCTTCCAGGATACGGCCACTGAGAGCGCGCAT
CCCATCCGTCTGTACTGCAGATATATAGACCGCATTCATA
TCTTCTTCAGGTTCTCTGCTGATGAGGCCAGAGATTTGAT
CCAGAGGTACCTGACTGAGCACCCGGACCCCAACAATGAG
AACATTGTGGGGTACAACAATAAGAAATGCTGGCCTCGAG
ATGCTAGGATGAGACTGATGAAACATGATGTCAACTTGGG
TCGTGCTGTGTTCTGGGACATCAAAAATCGCCTCCCTCGT
TCAGTGACCACAATTCAATGGGAGAACAGTTTTGTGTCTG
TGTACAGCAAGGACAACCCCAATCTGCTCTTTAACATGTG
TGGCTTTGAGTGTCGCATACTCCCGAAGTGTCGCACTAGT
TATGAGGAGTTCACTCACAAAGATGGTGTTTGGAATTTGC
AGAATGAGGTAACAAAAGAAAGGACAGCACAGTGTTTCCT
GCGTGTAGATGATGAGTCCATGCAAAGGTTCCACAATAGA
GTGCGACAAATTTTGATGGCTTCTGGGTCCACCACTTTCA
CCAAGATCGTGAATAAGTGGAACACTGCTCTGATTGGTCT
GATGACCTACTTCCGTGAAGCTGTGGTCAACACTCAAGAG
CTTCTGGACCTGTTGGTGAAGTGTGAGAATAAGATCCAAA
CCCGTATCAAGATTGGGTTGAACTCCAAAATGCCCAGCCG
TTTTCCTCCTGTGGTGTTTTATACCCCTAAGGAGTTGGGT
GGATTGGGAATGCTTTCCATGGGACACGTACTGATCCCAC
AGTCTGACCTTAGGTGGTCCAAACAGACCGATGTGGGTAT
CACTCATTTCCGCTCTGGTATGAGTCATGAGGAGGATCAG
CTTATTCCTAATCTGTACCGCTACATCCAGCCATGGGAGA
GTGAGTTCATTGATTCTCAGAGAGTTTGGGCTGAATATGC
CCTCAAGCGACAGGAGGCCATTGCTCAGAACAGACGTTTG
ACACTGGAGGATTTGGAGGACTCCTGGGACAGAGGTATTC
CACGTATCAACACCCTCTTCCAGAAGGACAGACATACTCT
TGCTTATGATAAGGGCTGGAGAGTCAGAACAGACTTCAAG
CAATACCAGGTGCTGAAGCAAAATCCATTCTGGTGGACTC
ACCAAAGGCATGATGGAAAACTATGGAATTTGAACAATTA
CCGAACAGACATGATCCAGGCACTTGGAGGGGTTGAAGGC
ATTCTTGAGCACACACTGTTCAAGGGTACCTACTTCCCTA
CCTGGGAGGGTCTCTTCTGGGAGAAGGCCAGTGGTTTTGA
AGAGTCTATGAAATGGAAGAAGCTCACTAATGCTCAGAGA
TCTGGTCTGAACCAGATTCCTAACCGACGATTCACCTTGT
GGTGGTCTCCTACCATCAACAGAGCCAACGTATATGTAGG
TTTCCAAGTGCAGTTGGACCTCACTGGAATCTTCATGCAT
GGTAAAATCCCAACCCTCAAGATCTCTTTGATCCAGATCT
TCAGAGCTCACTTGTGGCAGAAAATTCATGAGAGCATTGT
CATGGATCTCTGTCAGGTGTTTGACCAAGAGCTGGATGCT
TTGGAGATTGAGACTGTCCAAAAAGAGACAATCCATCCCA
GGAAGTCTTACAAGATGAATTCCTCCTGTGCGGACATTCT
TCTGTTTGCCTCCTACAAGTGGAATGTCTCACGCCCCTCA
CTTCTAGCAGATTCCAAGGATGTAATGGACAGCACCACCA
CACAGAAATTCTGGATTGACATTCAGCTCAGATGGGGTGA
CTATGACTCTCATGACATTGAGAGATATGCCAGGGCCAAG
TTCTTGGACTACACCACTGACAACATGAGTATTTACCCAT
CACCCACTGGAGTTCTGATTGCCATTGATCTGGCCTACAA
TCTTCACAGTGCCTATGGAAACTGGTTTCCCGGAGCCAAG
CCTCTGATCCAGCAGGCAATGGCAAAGATAATGAAGGCCA
ATCCGGCTCTGTATGTGTTAAGAGAGCGAATCCGCAAGGG
TCTGCAACTCTACTCTTCAGAGCCCACTGAGCCTTACCTG
TCCTCCCAGAACTATGGAGAGCTCTTCTCAAACCAGATCA
TCTGGTTTGTAGATGACACCAATGTGTACAGAGTCACCAT
CCACAAGACCTTTGAAGGTAACTTGACCACCAAACCCATC
AATGGAGCCATTTTCATCTTCAACCCCAGAACTGGACAGC
TTTTCTTGAAGATCATTCACACTTCTGTATGGGCTGGACA
AAAGCGTCTTGGACAGTTGGCTAAGTGGAAGACTGCTGAA
GAAGTGGCTGCCCTGATCCGATCGCTGCCTGTTGAAGAGC
AGCCCAAACAGATTATTGTGACCAGGAAGGGCATGTTGGA
TCCTCTTGAGGTGCACTTGCTGGACTTCCCCAACATTGTA
ATCAAAGGCTCTGAGCTCCAGCTCCCCTTCCAGGCCTGTT
TGAAAGTGGAGAAGTTTGGAGACCTCATTCTGAAGGCCAC
AGAGCCTCAGATGGTCCTGTTCAATCTGTATGACGACTGG
CTGAAGACCATCTCCTCTTACACTGCATTCTCTCGTTTGA
TTTTGATCCTGAGAGCGCTTCATGTCAACAATGATCGTGC
CAAAGTTATTCTGAAACCTGACAAGACCACCATTACCGAG
CCCCACCACATCTGGCCCACTCTGACGGATGAGGAGTGGA
TCAAAGTGGAGGTGCAGCTCAAAGATCTCATCCTGGCTGA
CTATGGCAAGAAGAACAATGTGAATGTGGCATCTTTGACT
CAGTCTGAAATCAGGGACATCATCCTGGGAATGGAAATCT
CTGCTCCATCCCAGCAGAGACAGCAGATCGCTGAGATTGA
GAAGCAGACCAAAGAGCAGTCTCAGCTTACGGCCACTCAG
ACTCGCACAGTCAACAAACACGGAGATGAGATCATCACCT
CCACCACCAGCAACTACGAGACGCAGACCTTCTCTTCCAA
AACTGAATGGAGAGTAAGGGCGATCTCTGCTGCAAACTTG
CACTTGCGTACCAACCACATCTATGTGTCATCGGATGACA
TCAAAGAAACGGGCTACACTTACATCCTGCCCAAGAACGT
TCTGAAGAAGTTCATCTGCATCTCAGATCTGCGTGCTCAG
ATTGCAGGTTACCTGTATGGAACCAGCCCTCCAGATAACC
CTCAGGTGAAGGAGATCCGCTGTATTGTGATGGTGCCACA
GTGGGGTACACATCAGACCGTTCACCTTCCCAACCAACTG
CCACAACACGAGTACTTGAAGGAAATGGAGCCTCTTGGAT
GGATCCATACACAGCCCAATGAATCGCCCCAGCTCTCTCC
TCAGGATGTCACCACCCATGCAAAGGTCATGGCTGACAAC
CCATCCTGGGATGGCGAAAAGACTATCATTATCACTTGCA
GCTTCACCCCTGGTTCCTGCACACTGACGGCCTACAAGCT
GACTCCCAGTGGATATGAGTGGGGTCGACAAAACACAGAT
AAGGGTAATAACCCCAAAGGTTACTTGCCTTCACACTATG
AAAGGGTTCAGATGCTTTTGTCTGACCGTTTCCTTGGCTT
CTTCATGGTGCCTGGCCAAGTCTCCTGGAACTACAACTTC
ATGGGTGTCCGCCATGATCCCAACATGAAGTATGACCTGC
AGTTGGCCAATCCGAAAGAGTTCTACCATGAAGTCCACAG
ACCGTCTCACTTCCTCAATTTTGCTTCTCTGCAGGAGGGT
GAAATCTACAATGCTGACCGTGAGGATATGTATGCATAAG
TACAAACAGAGACTATTTAAAGTAAAAGCACCCACAGGCT
AAAGCAATGCTTTGGTTCTGTTTTGTCCCTCTATACTGTT
AGCAGTAATGTAAATGCTTGGAAACTCGAAGCATGTCATC
TGTTTTTTGCTTTATCATTAATTGCTTGTCATTGACTTGA
TTATGCACAAGTCTGAAAGCACATTGTGCTTTGTCTGTTG
TTGTGAGATGAATGACTTTTTTGTCTAAAAATATCTGTAC
CCTTTTTCGGAGTTGTTTGTAGTACATTGTGTTTTTTATA
AATCCGGAATAATTTGTCTTTTCCCTGTAGCTATGTTGTG
CATCTGTTATGTACACTGTAGTTTGGGTTTAAATAAAGAT
TACAACTTTTATAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
prpf8-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000025885 (1),  Ensembl_Trans:ENSDART00000134601 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC049465 (1) 2224 bp
GenBank:EE301914 (1) 871 bp
GenBank:CK016777 (1) 866 bp
GenBank:CK144073 (1) 843 bp
GenBank:CT609020 (1) 835 bp
GenBank:CT665484 (1) 811 bp
GenBank:CF549668 (1) 783 bp
GenBank:CT588491 (1) 782 bp
GenBank:EG568233 (1) 781 bp
GenBank:CT584756 (1) 769 bp
GenBank:CN501758 (1) 764 bp
GenBank:CT609021 (1) 700 bp
GenBank:BI889760 (1) 630 bp
GenBank:AI545006 (1) 616 bp
GenBank:EB905577 (1) 611 bp
GenBank:AI558548 (1) 588 bp
GenBank:EB922035 (1) 581 bp
GenBank:CK676397 (1) 547 bp
GenBank:AI545392 (1) 524 bp
GenBank:EB965118 (1) 508 bp
GenBank:EB962966 (1) 474 bp
GenBank:BF717969 (1) 382 bp
GenBank:CT584345 (1) 373 bp
GenBank:AW778259 (1) 340 bp
GenBank:CT589661 (1) 212 bp
CITATIONS (2)