Transcript

itgb1a-201

ID
ZDB-TSCRIPT-090929-8570
Name
itgb1a-201
Previous Names
  • itgb1a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000025864 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000025864|OTTDARG00000020620|ZDB-GENE-060803-2 itgb1a|OTTDARP00000021252 itgb1a-001 LG_ BX322549.5 Danio rerio protein_coding KNOWN, 3414 bp
CCAGCGCAGTGTTGAGCGTCCAGCCGCTCTTCACTAATGC
GAACAAACACACGATAATATAACCTGGAATACTTAATTTC
ACACCGACGGGCGCAGGATGGGTTTCTCCGTCTGATTAGT
CCAGTCTGAAGGATTTAAAAGAAGATTTTAGAGGGTTAAA
GGAAAACTGAAGGATACACGTTGACAAAGACCCGATGAGG
CTTCGAAAGTGAAGAGAGAAAACTAGTAATTAAAGCCAAA
AAGATGGACCTGAAGCTACTTTTCATATCAGCATTATTAG
GCATCATCAGCTGCAGTCATGCACAGCAGGAGGGCAACGA
GTGCATTAAAGCCAACGCTTTGTCCTGCGGCGAGTGCATA
CAAGTGGGGGACAAATGTGGATGGTGCACTGATGCGGAGT
TTCTGAAGCAGGGAGAGCCGACATCGGCGCGCTGTGATGA
GCTGGAGTCGCTCAAGAAAAGAGGCTGCGCAGAAGATAAG
ATCGAGAACCCGCACGGCAGCCAGAGAATCCTGAAGAATA
CACCGGTGACCAACCGCAAGAAAGGAGCCGAGAAACTCCG
ACCCGAGGACATCACGCAGATCCAGCCTCAGAAACTCAGC
CTCCAGCTCAGATCCGGAGAACCTCAGAATATTAAACTGA
AGTTCAAGCGGGCTGAGGACTATCCCATAGACCTGTACTA
CCTGATGGACCTGTCCTACTCCATGAAGGACGACCTGGAG
AACGTTAAAAACCTGGGGACGAGTCTGATGAAGGAGATGT
CCAAGATCACCTCAGACTTCAGGATAGGTTTTGGCTCTTT
TGTGGAGAAGACCGTCATGCCGTATATCAGCACGACTCCG
GCCAAGCTTCTAAACCCCTGCACTGGAGACCAGAACTGCA
CCAGCCCCTTCAGCTACAAAAACGTGCTCAAACTGACCAG
CAACGGGCAGCGCTTCAACAGCCTGGTGGGACAACAGCAG
ATTTCTGGAAACCTGGACTCTCCTGAGGGAGGATTCGATG
CCATCATGCAAGTGGCCGTCTGTGGAGAGCACATTGGCTG
GAGAAACGTCACCCGTTTGTTGGTTTTCTCTACTGACGCA
GGTTTTCATTTTGCTGGAGATGGGAAACTCGGAGGAATTG
TGCTTCCCAATGATGGGAGGTGTCACTTAGAAAATGACAT
GTACACCATGAGCCATTATTACGATTACCCCTCGATCGCC
CACTTGGTTCAGAAACTGAGTGAAAACAACATCCAGACCA
TCTTCGCTGTTACAGAAGAGTTTCAGCCTGTATATAAAGA
ACTCAAAAATCTGATTCCAAAGTCTGCAGTCGGCACGCTT
TCAGCAAACTCCAGCAACGTTATCAATCTCATTGTTGATG
CTTATAATTCTCTTTCCTCAGAGGTGATCCTGGAGAACAG
TAAGCTTCCTGAAGGAGTGACCATCACATATCAGTCGCGC
TGTAAGAACGGTGTGGTCAACGAAGGAGAGAGTGGAAGGA
AATGCTCCAACATCTCAATCGGAGACGAGGTGTCGTTCAA
CATTAACATCACGGCTCAAGGCTGCCCTAAACAAGGCAAG
ACAGAGACCATAAAGATCAAGCCGCTGGGCTTCACTGAGG
AGGTGGAGATAACACTGAGCTTCATCTGCGAATGCGAATG
CCACAAACACGCCATGAAGAACAGCCCGCTGTGCCACAAC
GGCAATGGCTCCTTTGAGTGCGGAGCCTGCAGGTGTAATA
AGGGTCGTGTGGGTCGTCAGTGTGAGTGCCGGAAGGATGA
AGTGTCCACCGAGGATCTGGACAAGAACTGCCGCAAAGAC
AACGGCACCGACATCTGCAGCAACAACGGCGAGTGTGTGT
GCGGGACCTGCGAATGCAAGAAGCGGGAGAATCCAGAGGA
GCGATACAGCGGGAAATACTGCGAGTGCGACAACTTCAAC
TGCGACCGCTCCAACAACAAACTCTGCGGAGGTCACGGCC
GCTGTGAGTGCAGGGTGTGTGTGTGCGACGCCAACTACAC
AGGCAGCGCCTGCGACTGCTCCCTCGACACCTCCACCTGT
CTGGCCTCCAACAAGCAGATCTGCAACGGCCGGGGGATCT
GTGAGTGCGGGACCTGCAGGTGCACAGACCCCAAGTTCCA
AGGGCCCACCTGCGAGATCTGCCCCACCTGCCCCGGAGTC
TGCACCGAACACAAGGAGTGTGTTCAGTGTCGTGCGTTCG
GCACCGGAGAGAAGAAGGACACCTGTAAGCGCGACTGCAG
CTACTTCAACCTGATCGAGGTGGAGGATCGAGACAAACTC
CCGCAGCCGGTGCAGGCCTTTCCACTAATGCACTGCAAGG
AGAGAGATGCGCGAGACTGCTGGTTCTACTACACATACGC
CGTCAACAACAACACAGAGAAGGAGGTGCACGTCGTCAAG
ACCATGGAGTGTCCGCCGGGTCCAGATATCATCCCCATCG
TGGCCGGTGTAGTGGCAGGAATCGTGCTGATCGGTCTCGC
TCTGCTGCTCATCTGGAAGCTGCTCATGATCATCCACGAC
CGACGTGAATTCGCCAAATTCGAGAAGGAGAAGATGAACG
CCAAGTGGGACACGGGAGAAAACCCCATCTACAAGAGCGC
CGTCACAACTGTGATCAACCCCAAATACGAAGGCAAATAA
TGGCCATCAGAATCACTCACCAGGATGTTTGGCAAGGGAT
GGGTGTGCGGATTTCCTCCCTATTTCTTTATTTTCTCATT
CGTTTAGATCAATACTAGGAAGTTGTATTTCATGTCCGCC
TCTCATCCCTTGCAAACCTGTACAGTCTGTATAGTCTTTT
AACTTTCATTGGTTTTCCTTCTTTTACACCCTGTGCACAT
TCACGCAATCTCTCAATTCAGAACCGACAGATATCTGTGC
CTTTGCATAAAGCTTTATATAAAAGGGATCCTTAAAAATC
CAGACTTAGTGGAAATACAGGCCTACAGTATTGAAAAACA
TGCAATGCATTGCTCCAGGTACGTTTCGTTGTACGTTTCA
GATGACAAATCCACTAGAGGGCGGAAGATTTTTGGAAATT
TACATAAGTTAAGGCCACAGTGCAGTTAATTTTTATTCTT
AAAAAATAAGTTTAAAGGTGCTCTGACTCTCCTAAAGCAT
AAAAACACCCTAATATGTGCAGATATTTCAGAAACATGCT
CAGTGAACATTCCTGTTTATCTGAAATGCAATGCTGAAGT
CAGATATTCTGCTTTGAACTTGTCCGTTACGTCGTTTGTC
TTTGTTTTGGTCTCTTTAACCCACCCAGTATAGCCACGTC
TATTTCAGAACCCCGGGTTGCCAGATGGTGGAAAACACCG
TATTTGATTCATTCAGTCAGAAGGCTCTCAAAGCATGCGT
CTGTGACTGAAATACGACGTCTGGTGGACAGTAGCAGACT
CCAAAATGAGACGC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations