ZFIN ID: ZDB-TSCRIPT-090929-8570
Transcript Name: itgb1a-201
Previous Name: itgb1a-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000025864 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000025864|OTTDARG00000020620|ZDB-GENE-060803-2 itgb1a|OTTDARP00000021252 itgb1a-001 LG_ BX322549.5 Danio rerio protein_coding KNOWN, 3414 bp
CCAGCGCAGTGTTGAGCGTCCAGCCGCTCTTCACTAATGC
GAACAAACACACGATAATATAACCTGGAATACTTAATTTC
ACACCGACGGGCGCAGGATGGGTTTCTCCGTCTGATTAGT
CCAGTCTGAAGGATTTAAAAGAAGATTTTAGAGGGTTAAA
GGAAAACTGAAGGATACACGTTGACAAAGACCCGATGAGG
CTTCGAAAGTGAAGAGAGAAAACTAGTAATTAAAGCCAAA
AAGATGGACCTGAAGCTACTTTTCATATCAGCATTATTAG
GCATCATCAGCTGCAGTCATGCACAGCAGGAGGGCAACGA
GTGCATTAAAGCCAACGCTTTGTCCTGCGGCGAGTGCATA
CAAGTGGGGGACAAATGTGGATGGTGCACTGATGCGGAGT
TTCTGAAGCAGGGAGAGCCGACATCGGCGCGCTGTGATGA
GCTGGAGTCGCTCAAGAAAAGAGGCTGCGCAGAAGATAAG
ATCGAGAACCCGCACGGCAGCCAGAGAATCCTGAAGAATA
CACCGGTGACCAACCGCAAGAAAGGAGCCGAGAAACTCCG
ACCCGAGGACATCACGCAGATCCAGCCTCAGAAACTCAGC
CTCCAGCTCAGATCCGGAGAACCTCAGAATATTAAACTGA
AGTTCAAGCGGGCTGAGGACTATCCCATAGACCTGTACTA
CCTGATGGACCTGTCCTACTCCATGAAGGACGACCTGGAG
AACGTTAAAAACCTGGGGACGAGTCTGATGAAGGAGATGT
CCAAGATCACCTCAGACTTCAGGATAGGTTTTGGCTCTTT
TGTGGAGAAGACCGTCATGCCGTATATCAGCACGACTCCG
GCCAAGCTTCTAAACCCCTGCACTGGAGACCAGAACTGCA
CCAGCCCCTTCAGCTACAAAAACGTGCTCAAACTGACCAG
CAACGGGCAGCGCTTCAACAGCCTGGTGGGACAACAGCAG
ATTTCTGGAAACCTGGACTCTCCTGAGGGAGGATTCGATG
CCATCATGCAAGTGGCCGTCTGTGGAGAGCACATTGGCTG
GAGAAACGTCACCCGTTTGTTGGTTTTCTCTACTGACGCA
GGTTTTCATTTTGCTGGAGATGGGAAACTCGGAGGAATTG
TGCTTCCCAATGATGGGAGGTGTCACTTAGAAAATGACAT
GTACACCATGAGCCATTATTACGATTACCCCTCGATCGCC
CACTTGGTTCAGAAACTGAGTGAAAACAACATCCAGACCA
TCTTCGCTGTTACAGAAGAGTTTCAGCCTGTATATAAAGA
ACTCAAAAATCTGATTCCAAAGTCTGCAGTCGGCACGCTT
TCAGCAAACTCCAGCAACGTTATCAATCTCATTGTTGATG
CTTATAATTCTCTTTCCTCAGAGGTGATCCTGGAGAACAG
TAAGCTTCCTGAAGGAGTGACCATCACATATCAGTCGCGC
TGTAAGAACGGTGTGGTCAACGAAGGAGAGAGTGGAAGGA
AATGCTCCAACATCTCAATCGGAGACGAGGTGTCGTTCAA
CATTAACATCACGGCTCAAGGCTGCCCTAAACAAGGCAAG
ACAGAGACCATAAAGATCAAGCCGCTGGGCTTCACTGAGG
AGGTGGAGATAACACTGAGCTTCATCTGCGAATGCGAATG
CCACAAACACGCCATGAAGAACAGCCCGCTGTGCCACAAC
GGCAATGGCTCCTTTGAGTGCGGAGCCTGCAGGTGTAATA
AGGGTCGTGTGGGTCGTCAGTGTGAGTGCCGGAAGGATGA
AGTGTCCACCGAGGATCTGGACAAGAACTGCCGCAAAGAC
AACGGCACCGACATCTGCAGCAACAACGGCGAGTGTGTGT
GCGGGACCTGCGAATGCAAGAAGCGGGAGAATCCAGAGGA
GCGATACAGCGGGAAATACTGCGAGTGCGACAACTTCAAC
TGCGACCGCTCCAACAACAAACTCTGCGGAGGTCACGGCC
GCTGTGAGTGCAGGGTGTGTGTGTGCGACGCCAACTACAC
AGGCAGCGCCTGCGACTGCTCCCTCGACACCTCCACCTGT
CTGGCCTCCAACAAGCAGATCTGCAACGGCCGGGGGATCT
GTGAGTGCGGGACCTGCAGGTGCACAGACCCCAAGTTCCA
AGGGCCCACCTGCGAGATCTGCCCCACCTGCCCCGGAGTC
TGCACCGAACACAAGGAGTGTGTTCAGTGTCGTGCGTTCG
GCACCGGAGAGAAGAAGGACACCTGTAAGCGCGACTGCAG
CTACTTCAACCTGATCGAGGTGGAGGATCGAGACAAACTC
CCGCAGCCGGTGCAGGCCTTTCCACTAATGCACTGCAAGG
AGAGAGATGCGCGAGACTGCTGGTTCTACTACACATACGC
CGTCAACAACAACACAGAGAAGGAGGTGCACGTCGTCAAG
ACCATGGAGTGTCCGCCGGGTCCAGATATCATCCCCATCG
TGGCCGGTGTAGTGGCAGGAATCGTGCTGATCGGTCTCGC
TCTGCTGCTCATCTGGAAGCTGCTCATGATCATCCACGAC
CGACGTGAATTCGCCAAATTCGAGAAGGAGAAGATGAACG
CCAAGTGGGACACGGGAGAAAACCCCATCTACAAGAGCGC
CGTCACAACTGTGATCAACCCCAAATACGAAGGCAAATAA
TGGCCATCAGAATCACTCACCAGGATGTTTGGCAAGGGAT
GGGTGTGCGGATTTCCTCCCTATTTCTTTATTTTCTCATT
CGTTTAGATCAATACTAGGAAGTTGTATTTCATGTCCGCC
TCTCATCCCTTGCAAACCTGTACAGTCTGTATAGTCTTTT
AACTTTCATTGGTTTTCCTTCTTTTACACCCTGTGCACAT
TCACGCAATCTCTCAATTCAGAACCGACAGATATCTGTGC
CTTTGCATAAAGCTTTATATAAAAGGGATCCTTAAAAATC
CAGACTTAGTGGAAATACAGGCCTACAGTATTGAAAAACA
TGCAATGCATTGCTCCAGGTACGTTTCGTTGTACGTTTCA
GATGACAAATCCACTAGAGGGCGGAAGATTTTTGGAAATT
TACATAAGTTAAGGCCACAGTGCAGTTAATTTTTATTCTT
AAAAAATAAGTTTAAAGGTGCTCTGACTCTCCTAAAGCAT
AAAAACACCCTAATATGTGCAGATATTTCAGAAACATGCT
CAGTGAACATTCCTGTTTATCTGAAATGCAATGCTGAAGT
CAGATATTCTGCTTTGAACTTGTCCGTTACGTCGTTTGTC
TTTGTTTTGGTCTCTTTAACCCACCCAGTATAGCCACGTC
TATTTCAGAACCCCGGGTTGCCAGATGGTGGAAAACACCG
TATTTGATTCATTCAGTCAGAAGGCTCTCAAAGCATGCGT
CTGTGACTGAAATACGACGTCTGGTGGACAGTAGCAGACT
CCAAAATGAGACGC

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
itgb1a-201 Contained in:
[BAC] DKEYP-9D12 (1)
OTHER itgb1a-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000025864 (1)
  • Ensembl_Trans:ENSDART00000039700 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:DQ149101 (1) 2397bp
    GenBank:EB989606 (1) 531bp
    GenBank:EB847707 (1) 524bp
    CITATIONS (2)