ZFIN ID: ZDB-TSCRIPT-090929-8538
Transcript Name: unc119.1-002
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000025831 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000025831|OTTDARG00000020599|ZDB-GENE-030219-130 unc119.1|no_translation unc119.1-002 LG_ CR376731.13 Danio rerio protein_coding KNOWN, 540 bp
TCCAGAGACCACAAATCAGGGGGCGGCGTCCTGAAACGGC
TAAAATCCCGACGAAATCAAGTGGACCGTCGGCCTGTAAC
GGAGGAAGAGCTGCGGGCGCTGGGCAGAGACATCACTCCG
GATGAAGTTTTGGGACTCCGCGCAGTCGCTCGCGACTATT
TGTGTAAACTAGAGGACAACATCTACAATATTGACTTTAC
ACGATTTAAGATCCGAGACCTGGAGACTGGGACAGTGCTT
TTTGAGATTGCCAAACCACCACACTGTGACCTTGATGAAG
AGGACGATGAAAACCGAGACGCTGACACCAGTGCGGGACG
ATTCGTTCGCTATCAGTTCACACCAGCATTCCTTAAGTTA
CGCACAGTCGGAGCCACGTAAGTCTCTCTAATAAACACAG
CCATGTGGATTCTGCAGTGTAAACAAACCTCCGCGAGTCT
GAAATTCACTTGACCAGCTTTCATGTTTAGAAACAAAGGC
CCTTGTGTGTCATATCCTGCAACACTTGAGCAACGTCTCT
AGCCCAATCCCACAGAAACC

unc119.1 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA unc119.1-002 540
mRNA unc119.1-201 (1) 5284
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
unc119.1-002 Contained in:
OTHER unc119.1-002 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000025831 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AL925230 (1) 539bp
    CITATIONS (1)