ZFIN ID: ZDB-TSCRIPT-090929-8537
Transcript Name: unc119.1-201
Previous Name: unc119.1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000025829 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000025829|OTTDARG00000020599|ZDB-GENE-030219-130 unc119.1|OTTDARP00000021232 unc119.1-001 LG_ CR376731.13 Danio rerio protein_coding KNOWN, 5284 bp
CGCGCTACGCCATCTTGCCATCTTGCGTCGAGCACCTCAA
CAGAGACGCGTTTCGCGCTCCGCAGCAACACAAGGGAAAT
TTCCGAGAGATGAACAGTCAGAGCTCCCGCAACGAGACGG
CAGCCACCGCTGTTAACGGCTCCGATTCAGCGGCGGCGTC
CAGAGACCACAAATCAGGGGGCGGCGTCCTGAAACGGCTA
AAATCCCGACGAAATCAAGTGGACCGTCGGCCTGTAACGG
AGGAAGAGCTGCGGGCGCTGGGCAGAGACATCACTCCGGA
TGAAGTTTTGGGACTCCGCGCAGTCGCTCGCGACTATTTG
TGTAAACTAGAGGACAACATCTACAATATTGACTTTACAC
GATTTAAGATCCGAGACCTGGAGACTGGGACAGTGCTTTT
TGAGATTGCCAAACCACCACACTGTGACCTTGATGAAGAG
GACGATGAAAACCGAGACGCTGACACCAGTGCGGGACGAT
TCGTTCGCTATCAGTTCACACCAGCATTCCTTAAGTTACG
CACAGTCGGAGCCACGGTGGAGTTCACAGTTGGCGATCAA
CCGGTCACTAATTTCCGAATGATTGAGAGGCATTATTTTC
AAGACCGCCTCCTGAAGAGTTTTGACTTCGACTTCGGCTT
TTGCATCCCCAACAGTCGGAACACGTGTGAACATATTTAC
GAGTTTCCTCAGCTCCCAGAAGACCTCATTCGACTAATGA
TTGAACACCCATATGAAACCAGATCAGACAGCTTCTACTT
TGTGGATAACAAACTCATCATGCACAACAAGGCGGACTAC
GCTTACAACGGAGGCCAGTAGTGCTGCTTCAGCAGGAAAC
CTGACCATTGTTTGTTGGAGTGACTGTGTGGGGTTCACTT
GGTTTGTGTTTGCGTGGAATGCAAATTCAACACAGACTCT
TACTACCAACAAAAACAAAACTATACACGTTGACACCAGC
ACACCATCATGGCACCATCGACCCACCCAACTGGAAATAA
TGACCATTCCTCTATGATGAAGTTCCTGCATTCCACTCTA
CTTGTGGGTCTGGCCAAAAAAATGAAGCATTTCTCCTTCG
ACTAGTCGGAAGCGAAGAATTCTGTCATCCTGCTTTTAGG
GTGACTACTATAGAGGAGTTTGGTTTTGTAACTTGCGTTG
TCTTCTTGCACCATTAACCTTTTGTCTTGAATTGTTTTTT
TGAAGTCGTGTTACCAAACATAATCTTGAACATCTGGATA
TTTTGGAATATTATTCAGATGTGCTAAGATAAAGCATTCC
TGCCGTAGGTTTGGTCACTAATGTGAAGTTGCACAGATTT
TGCTGTTTTATTATCAGTCATTAGAGGGAGAGAACAGCTT
GATTGGTGCACATCCTCTCTTTGTCAAAGTAAACTCTTAA
GATATTTTCAGATCGGTCAGCATGTCCGGTTCATGACGTG
TTATTTTTGTCACTCTGACCCTAAAACTGATCAAGTTCAC
GGTGTTTTGTTCAATTACTGTACTGTTTAAAGGTTGGGGT
CAGTAAAATGTCTAATGTAGACTCTACTGTTCATCAAGGC
TACATTTGATCAAAAACACTGTCAAATATCACTTTTGTGA
AATAGTGTTAGAACCTTTTTAAAAATCACAGTTTTTAATC
TTTTTTTTCTGCCATGGGATCAAAAATAAATTCATTTTGA
CTGCTAATCTCAATGATGGAAATTATTCTACAATAGCAAG
ATTTTATATCACAATTTTGAGGTAAGTATGCCAAGTATGC
AGTCTAAAATTGTGACTTCTTAATTTTAAAGTTTATATCT
TGCAGTTGTGTCTTATATCAGAGTTGTGATATAGTAATGC
AAAATCGAGAGATGCAGAGCTGCGTTTTCTAAAGAGGAGA
TCCTGAGGCTTAACTGGAATTCTATAGTATTAAGTTTAAT
ATCTTAAAATATATCAGATTAAATTTGTAATTCTTTAGAG
CTGTATTTCAGCATTATTACTCCATTTCTTAGTGTATCAT
GATCCCTCAAAAATCATTTCAATATGAAAAAAATTAAACC
ATAGTCTGACCTCATCAAAAAAGGATTTTTATTCATTTCT
TTTCTGTAAGTTAAGTCTCCATCTTGCTGGGGCAAAAAAA
AAAATGTCCTAGTTTGAAGTCCTGCGGGGGTCTGGAAGGG
GCATATAGCTGTATTTCCTATAGATTCCATCTGGTTTTGT
CGTGTACGAGGGCTTTGGATGTTACTCTCAGCTGTTCATA
CAGAAACACTCGTGTCACACACAGAGAGAGGGATGTGATT
CCCAACATGGTGTCCCTGTGCACCTTTCAAGCTGTTTAGC
CCCTTTCAGAGCTTTGATGTTTACCTTTGATCTAATTCAA
CAGGATGTTTAACAGCGGATATGAGTTAGGCTAAGAAAGT
GTTTTTTTTTTTATCTAAAAAGCTGCTGGAAGCCCATCAG
AGACCCCTTAACTTTACATATTTGAATATTCTGAACTTGA
TTTGATGAGCTTGTTATCAAAGCGAATCGTGCGCCGGTAG
GAAAACGGCTCTTGTTATTCATTCAAAAGTCAGTTCTCAA
CTCCCAATCCATCCGCTTGTAAAGTTTTGATGTGTAGGAT
ACTGTTTCTGGGTTCAAGCTTCTACACATTACAGAGAAAA
ATTGGCTGCGTTTCATATGGCAATATTTCGTTCACTTATA
ATCACGCTCCATATTAGTACAGCACACTGAAAAATTATTA
TTTGGGTTTACTCAATTTTTTAGGGTGAGTGGTTGCAAAC
AATTTAGATGGGCTGAATTTAAGCAAATTATTATTATTAT
TATTATTATTTAATTCAGCCCATAAAAATTGTTTGCAACA
TTAGCTTAAAAAAACTTTGTAAATCGAATATTTTTTTCAG
TGCGTATATATTGGTATATGATTTGTTGTTAGTTTTTAGA
ATTTAGACCCAGCATTTGGACCCAGAAACATGATGTCAGA
TTTAACAAGCTTCTATACATGTCTGTTTTAAGTGTCCTTA
AAAAAGAGAGATAACGAGGCTGAAGGAAGATTGTTTGTGT
AGTATTTGTGGATGATTGCGTGTCTGTCCGATGCCTTACT
CGTGCTGTTTACAGGTCCAGGTACCATCTATGGGATTTAC
CACACTGACTTGTCTGTATATCATGACAGACCAAACACAA
GAAAAAAGCTGCGTTCATGTCATATTGTGATTTCCAACAA
GTAAAAAGTGATCATGTCCTCGTACAACTTGTAAAGAGGG
ATTCTTTTTGAAAGCTTAAATCCCATGACTGCCATTGATT
CATTTTAGGTGCTGAGTTTGAGATTTTATAGTGTTGCCAT
AGACCAAGCAAACACAGAATGTTCTCCTGTCGTTCCCATG
GTTCACATCAAATTATATATATTTTTTTTAATAAATGCAA
AAACTAACAACCCAGAATGTTGCAGGGAGGTGGTTTTACA
ACTTAAGGAGAAATTGAGGGTTCTAACCTAGAGGGAACAT
TCTATTTACATTAAGCGTTCCTGACTGAATGTACTGAAAA
CCGTACACTAATATTTGTAGAATGGGTTCTGGGAATTAGA
ACATAACTATAGAACATAGAACATAATTCAGAGTCCGAGG
CTCTTGAGTTAAAACAACATGAAAAGTCATTTCAGATTGA
ACAATGTTAATTACGAGATTACATGAACGCATATATTTAG
GTTTGAAGCTTGATGCTCACTTTTCAGATAGGGGTGTGTG
ATATTGCAAACAAATGTGTCATCTCAATACTTTCAAGGAT
TTTTAATAATCATTTTTAATCTTTTGCTGTGTGTTTTGAT
TTCTGGCTTGTTTAGGTTTGACAAATGTAAACGTAAAACT
GCCAGTAGGTGTTGACAACTTAAAGAGGGATACATTCAAA
TGATTCAATCAAAATGGCTGATTCATTCAGAAATGTCGAA
AGCCACCCTTTTTCTTGTTTGTTATTAATGTAACATATCT
AGTGCATGAGGAAATAATTATACAATTAGAAGATCCTCAC
TTTTTAGTAAATGGGGGCCATGGTAAAGGTATGCATTTCC
TTGTAGATTTCTACCTAAATTCTGTTAAAAACTAACATTG
ATATTTCAAAGATTGCACTAAGGAGTAGTCATTGACTTCC
ATAATAGGAAAAAAACACTCTGGATGTCTACTGTTTTCTT
CAGCATTCTTTATAATATGGTCTCAACAGAAAATAACTTT
AAGTTAATTAGTGAAATAATCACAAAAACGACAATTACAG
TAATCGTACAGACAACAAATATTGCACACCTCTATTTTTG
CTCTCCTAAAATATTTTTAACCCAAGTTAAGGCCTGGTCA
ATGATAACTATTTTAACGTCCACACAAACAAAGGATTTTT
TTTTAATATTATGCAGCAGTTCTTTGCTCTTAAGACTTTA
AACTCCTCAGCTCATTAAAGCAGGATGAATTCTGATAGGC
TGTAAATATTTTATCATTCATCAGCTGGAAAAAAAAAAGA
AATATTGTTCCTCTTTGTTGTTATTTTTTTGTGCTGAAGT
ACATTTCTTTTTTTTTTTAATGTCCTAACTGTTACTGTTA
ATGTTTTTGATGTGTATGGGTCCTTCCATATGTTTCACTG
AGAGAGGTGTTAAGTGTCTATTAGTTTCTAAACCATGGGT
CTCAAAGCTTAATTCCTGGAGGGCCACAGCTCTGCACAGT
TTTGCTCCAACCCTAATCAAACACAGATGATCCAACTAAT
CAAGGTGTTCAAGACTACTCAGAGCAGCAGACCTGCGGCC
CTCCAGGAATTAAGTTTGAGACATATGTTATTAAGCATTT
CAGTTGACACAACAAGGATGTGATCTGTTCACTTTTGGTG
TTTTTTCTTCTTCTTTTTTTTGTCTTGCACTCTAATGTGT
GGATTTGGAAATATCCGTTGCTTTAGGAATGCTGCTTGTG
CTTTACATTTGTTGTGTATTATGGTGTCAACTGGAATACA
TTTGTCCTTTTATGTAGACTTTTATTATGTCAGATTTAAT
TACGCCTGTATCAGGACTTTTATTTTGACATATTTCGTTA
TACTACATTCTTTTACACTGACTGGTTTATACATTAACTG
GTAAAACCAAGACTAGTAAACCGGGTCCATTAAAATGAAT
AGGTACATTCGACTTTCATTTTCATTACTGACAAGTTTGA
GTGACACTGAAGGCTGAATGTTATATTCTCAAGACGAGAT
CAAGTTTCCCATTTTGTTATGTATAGTGTTGATAACTTTT
GAAAAATGAACCATTGTTTTATTATAATAAAAGTCTAGTA
ACCA

unc119.1 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA unc119.1-002 (1) 540
mRNA unc119.1-201 5284
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
unc119.1-201 Contained in:
OTHER unc119.1-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000025829 (1)
  • Ensembl_Trans:ENSDART00000019907 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AF387342 (1) 1678bp
    GenBank:DV596290 (1) 880bp
    GenBank:BC095577 (1) 834bp
    GenBank:AI793421 (1) 527bp
    CITATIONS (2)