header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-8523
Transcript Name: hoxb1b-201
Previous Names: hoxb1b-001, ottdart00000025815

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000025815 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000025815|OTTDARG00000020590|ZDB-GENE-980526-290 hoxb1b|OTTDARP00000021221 hoxb1b-001 LG_ BX001014.6 Danio rerio protein_coding KNOWN, 1606 bp
ATTTATAGCTCGCTAAACAAATACAGTTGTCCTCACCGTC
ACAGGTACACAATAGCTATAAATTATCTCTTGCTGTACTC
GCTTTAATTCACATTAGACCTACATAGCGACTTTATCAGA
TTGACGGGTGGATTCGATTGATGTGTTTGTCATGTAAATA
CGAATCGTTTGATGGACACCTGCAACGCCCAGAGTGCTAC
CGCAGGTCGCACACTATTGGCGCAAAATTAGTCACATGAT
CTGTCACTTAACTGATATGAGCTCAGATACAACTTTGCGT
GGTTTGACATACTGCTTAGAGGTTGTAGGGGCACTGGGAC
CACACATCAGCTCATATTGACCCTGCTTAATCAATTTTGC
TTGGTCAGTCAACAATGAATTCTTACTTAGATTATACGAT
TTATAACCGTGGTTCTAACACTTATAGTTCGAAAGTTGGG
TGTTTTCCTGTAGAGCAAGAATACTTGCCAAGTGCTTGTG
CAAGTACAAATAGTTACATTCCCGAGGGACGGCCAGTCGG
AGGAAACACTTTCACATCGGCACCGCACGAAACTCATGGC
ACATCTTACGCACAAATTCAATCGCAGCCCTTCCACCTCA
ACGTGGACATGGGTAAAACAGGACACAGCAATTTCTGCAA
GCAAACCAGACCTCCTCATTCGGACTATGGACATCAACAC
GTTCTCACTCAAGCAGATGACCACATGCGCCTTCAGTCCC
CTGGCTTTTCCGTCGTGAATATGGGAGCCAATATTGGAAC
TTACAGTGAATCAAACTGCAGGCCTGGCTCGGTCTCTGCA
AGCCACTATCAATCATATGCATATGGAGAACCCGAACCAC
ACGGCTATGGTTCGTTCAGCAAGTATCAGGTCTCCCCTGA
CAGTGACAGCGACTCCAAGACGAACATTAAACAAGCGCCA
ACCTTTGACTGGATGAAAGTCAAGAGGAATCCCCCTAAAA
CAGTTAAAGTCGCCGAATACGGAATCCATGGCCAGCAGAA
CATAATACGCACCAATTTCACCACCAAGCAGCTCACGGAA
CTTGAGAAGGAGTTTCACTTCAACAAATACTTGACCAGAG
CGCGCAGAGTGGAGGTGGCCGCCACACTCGAACTGAACGA
AACGCAGGTTAAAATCTGGTTTCAGAATCGCAGAATGAAG
CAGAAGAAGCGCGAGAAGGAAGGCACGGCCCCGGTGATTA
AAAGAGTAACCCTTTGCTCTTCTGGTCAAAACGCAGACCA
CTCAACTAGCTCATCGCCTGGTGCTTCGCCTACCTCGGAC
TCTTCCACTGCAATTTGATGAGTGCCAGACTTTCGTTTCG
TTGCTGGAGGACTATTTAACTTATTCTGTCGTAGAAAAAA
ATATTGTTTACGTGCTATTTGTGTTTTTGTGCTGCATTAG
AACTACTAAATAGATGCATTAACAGGGTATATGCTTAACG
TTCAAATGTTCTTTTTCTTGTTGTTGTCGTCCGGTCAATT
ATTTTGCACTACAGATTCATTCCTCTGTTGAAAGAGTAAT
AAAATGTGAAAAAGACTGACATGTTTATGTATTTCGAATA
TATTCGGACCTGTGACCTGATAAATAAATATTTTATTTTT
CTGAAA

hoxb1b TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA hoxb1b-001 (1) 1310
hoxb1b-201 1606
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
hoxb1b-201 Contained in:
[BAC] DKEY-11C5 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000025815 (1),  Ensembl_Trans:ENSDART00000136415 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC133876 (1) 1628 bp
GenBank:AJ306433 (1) 924 bp
GenBank:CT649122 (1) 839 bp
GenBank:DQ060546 (1) 300 bp
CITATIONS (2)