ZFIN ID: ZDB-TSCRIPT-090929-22918
Transcript Name: hoxb1b-001
Previous Name: ottdart00000001796

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status: fragmented
Strain: AB
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000001796 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000001796|OTTDARG00000001682|ZDB-GENE-980526-290 hoxb1b|OTTDARP00000001584 hoxb1b-001 LG_ AL645798.2 Danio rerio protein_coding KNOWN, 1310 bp
GCTTAGAGGTTGTAGGGGCACTGGGACCACACATCAGCTC
ATATTGACCCTGCTTAATCAATTTTGCTTGGTCAGTCAAC
AATGAATTCTTACTTAGATTATACGATTTATAACCGTGGT
TCTAACACTTATAGTTCGAAAGTTGGGTGTTTTCCTGTAG
AGCAAGAATACTTGCCAAGTGCTTGTGCAAGTACAAATAG
TTACATTCCCGAGGGACGGCCAGTCGGAGGAAACACTTTC
ACATCGGCACCGCACGAAACTCATGGCACATCTTACGCAC
AAATTCAATCGCAGCCCTTCCACCTCAACGTGGACATGGG
TAAAACAGGACACAGCAATTTCTGCAAGCAAACCAGACCT
CCTCATTCGGACTATGGACATCAACACGTTCTCACTCAAG
CAGATGACCACATGCGCCTTCAGTCCCCTGGCTTTTCCGT
CGTGAATATGGGAGCCAATATTGGAACTTACAGTGAATCA
AATTGCAGGCCTGGCTCGGTCTCTGCAAGCCACTATCAAT
CATATGCATATGGAGAACCCGAACCACACGGCTATGGTTC
GTTCAGCAAGTATCAGGTCTCCCCTGACAGTGACAGCGAC
TCCAAGACGAACATTAAACAAGCGCCAACCTTTGACTGGA
TGAAAGTCAAGAGGAAACCCCCTAAAACAGTTAAAGTCGC
CGAATACGGAATCCATGGCCAGCAGAACATAATACGCACC
AATTTCACCACCAAGCAGCTCACGGAACTTGAGAAGGAGT
TTCACTTCAACAAATACTTGACCAGAGCGCGCAGAGTGGA
GGTGGCCGCCACACTCGAGCTGAACGAAACGCAGGTTAAA
ATCTGGTTTCAGAATCGCAGAATGAAGCAGAAGAAGCGCG
AGAAGGAAGGCACGGCCCCGGTGATTAAAAGAGTAACCCT
TTGCTCTTCTGGTCAAAACGCAGACCACTCAACTAGCTCA
TCGCCTGGTGCTTCGCCTACCTCGGACTCTTCCACTGCAA
TTTGATGAGTGCCAGACTTTCGTTTCGTTGCTGGAGGACT
ATTTAACTTATTCTGTCGTAGAAAAAAATATTGTTTACGT
GCTATTTGTGTTTTTGTGCTGCATTAGAACTACTAAATAG
ATGCATTAACAGGGTATATGCTTAACGTTCAAATGTTCTT
TTTCTTGTTGTTGTCGTCCGGTCAATTATTTTGCACTACA
GATTCATTCCTCTGTTGAAAGAGTAATAAAATGTGAAAAA
GACTGACATGTTTATGTATTTCGAATATATTAGGACCTGT
GACCTGATAAATAAATATTTTATTTTTCTG

hoxb1b TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA hoxb1b-001 1310
hoxb1b-201 (1) 1606
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
hoxb1b-001 Contained in:
OTHER hoxb1b-001 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000001796 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AJ306433 (1) 924bp
    GenBank:BG985541 (1) 549bp
    GenBank:BI709719 (1) 547bp
    GenBank:BI708332 (1) 533bp
    GenBank:BQ169343 (1) 511bp
    GenBank:BI892355 (1) 368bp
    CITATIONS (1)