Community Action Needed: Please respond to the NIH RFI
Transcript

etv4-201

ID
ZDB-TSCRIPT-090929-8508
Name
etv4-201
Previous Names
  • etv4-001
  • pea3-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000025800 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000025800|OTTDARG00000020582|ZDB-GENE-990415-71 etv4|OTTDARP00000021209 pea3-001 LG_ AL833789.20 Danio rerio protein_coding KNOWN, 1957 bp
AAATGAAGCAAAGAAGAGGTCTCGAGCTGTCCAAACAGTG
ATTTAGCAGAGCCTAGAGTGTGTGTGTTTATACGCACGCT
GGTGGTTTTTTTGTGAATGGAGCTCATTACGTATGCAGCC
TTCTCGCGCTCCATTCACAAACTACCGCTGCTGCTGCTGC
CTCTGTCCGTCTTCCTTCCCCTCTCAGTCTGCGTGGAGCT
CATTAAAACACAGCCTAAATGACCACAAACGGTTAAGGCA
TGGATTATAAGATGGATGGATATCTGGACCAGCAAGTGCC
TTATACTTTAGCTAATAGGTCGCAAGGAAATGGGCCCCTA
AATAGACTGTTGATGGCGACAAAAAGGAAATACATGGACG
CAGAATTACCCCCTCAGGAATCTGAAGACCTCTTTCAGGA
TTTAAGCCAACTTCAGGAGACCTGGCTCACCGAAGCTCAA
GTTCCTGACAGCGATGAGCAGTTTGTTCCTGACTTTCACT
CAGAGAACTCAGTGGCATTCCACAGCCCGCCTGTGAAGAT
TAAGAAAGAGCCGCAGAGTCCCGGATCAGACCCCAGCCAG
TCCTGCAGCCACAAGCAAAGCTTCAGCTACCCCAATGGAG
AGCAGTGCCTTTACGCCAGTGCCTATGAGCAGAAGAGAGC
AGCCGTGGCAGGAGCAGGAGGATCTAAGAGCTCATGTCCA
GGGACGCCCATGTCCCCTATGCAGCATTATTCCCCCAAAC
CAACAGTGGGAACTCGGCAGGAATCAGGGTATATGAATCC
ACCCTCAGCCAGCCAATCCCACGCCTGCCACAGCCACAGT
TACCCCATGAACCCCAGTTCCAGGTTCCCTTCCGGCTCGG
CAGAGATGTGCCCACCATTCGCTTCCCAAGGCCAGGCCCT
GCAGCGCATGCATCCTGCCCATGCCAGCGGAGGCGGAGGA
GGCGGTTACCATCGGCAACACTCTGACCCCTGCTTGCCTT
ATCCTCCTCAGCAGACCTTTAAGCAGGAGTACATGGACCC
TCTGTATGACCGAGCGGCCCACATTAACGGACCACAGCCT
CAGAGGTTTCCTCCTGCCCATATGATGGTCAAACAGGAGC
CCACCGACTACACTTACGAACCTGATGTGCCTGGCTGCCC
ATCCATGTACCATCACAACGAAGGCTACTCCAACCCACAG
CACAACAGTGAAGGCTACATGTTTGAAAATGATTCCCGTG
TTGTGCCAGAGAAATTTGAAGGTGAGGTGAAACAAGAAGG
GGGCAGTGTGTTTCGTGAAGGTGCCCCCTATCAGCGTCGT
GGCTCACTTCAACTATGGCAGTTCTTGGTTGCCCTTCTTG
ATGACCCCAGCAATGCCCACTTCATCGCATGGACGGGCCG
TGGCATGGAATTCAAACTCATTGAGCCAGAGGAGGTGGCA
AGACTCTGGGGGATGCAGAAGAACCGTCCAGCCATGAACT
ATGACAAACTGAGTCGCTCTTTGCGTTACTATTATGAGAA
GGGAATTATGCAAAAGGTGGCTGGTGAGCGTTATGTTTAC
AAATTTGTGTGTGAGCCAGAAGCTTTGATATCCTTGGCTT
TTCCCGACAATCAGCGGCCAAGTCTGAAGGCGGAATTTGA
GCGCTACGTCAACGAGGAGGACACTGTGCCACTGTCCCAC
CTCGATGAGGGAGTTTCTTACCCTCCCGAACCAGCTGCCA
CCAACATGGGCCCTCAGCCCTACTCCAAAGGCTACATGTA
CTAATGCCACCGACATTCTCCTTTGTTTCCCATCCCAGTT
TACCACCCGCTGCACCTATTGCACATGCCCACCCCATCCT
CTTGTATATAAGGCTATGTTTTATGTTTTTGTTTTGATTA
AATTAATCTCATTAGGGACTCTGCATTCCTCTCACTTCTG
AGGCCTATCTAATCTAAACACAATACTGTGGTTCAAGAGA
TTGCTTAATAAAACCCAATATTACTACTATAAAACGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations