Transcript

six3b-201

ID
ZDB-TSCRIPT-090929-8507
Name
six3b-201
Previous Names
  • six3b-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000025798 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000025798|OTTDARG00000020580|ZDB-GENE-990415-128 six3b|OTTDARP00000021208 six3b-001 LG_ CR932018.11 Danio rerio protein_coding KNOWN, 1759 bp
GTGATTGGCAGGGCTGCCATGACAACCACAGCACGACACC
AGGAAGACCAATAGAAAAGCGAAACAAAATGTTTCACCGT
TGCACTCTAAGTTGATTAAGGGTAGATATTCGCGCTCGGT
GGCACTGCGGCGATAGCAGCGCAAACACGACGTCGGGTTT
TCCGTCTTTCCCCGTCGTTTTGTCTCTGTCCGGCGACTCC
ATGGTTTTCAGGTCTCCTTTAGAGCTTTATCCCTCACATC
TTTTCCTGCCCAATTTCGCGGATCGCCCTCTGCTTCTGGC
GGGCAGCATTCCCAGAGCGAGGTCCCCGGAGGACTTACCG
ATGTTTCAGCTGCCCACCCTAAACTTCTCGGCGGAACAGG
TGGCCAGCGTGTGCGAGACGCTGGAGGAAACCGGGGACAT
CGAGAGGCTCGGACGTTTCCTTTGGTCGTTGCCCGTAGCA
CCCGGAGCCTGCGATGCCATCAACAAGCACGAGTCCATCC
AGCGAGCCCGAGCGGTGGTCGCGTATCACACGGGAAGCTT
CCGTGAATTATACCACATCCTGGAAACCCACAAGTTCACC
AAAGACTCTCATGGAAAGCTGCAAGCGATGTGGCTGGAAG
CGCACTACCAAGAAGCAGAGAAGCTGCGCGGCCGTCCCCT
TGGACCCGTTGATAAATACCGGGTCCGCAAGAAGTTTCCT
TTGCCACGGACCATCTGGGATGGCGAACAGAAGACGCACT
GTTTCAAGGAACGAACTCGCGGTTTGTTGAGGGAGTGGTA
CCTACAGGACCCTTACCCCAATCCGAGCAAGAAAAGGGAA
CTGGCACAAGCCACTGGACTGACTCCCACTCAAGTGGGCA
ATTGGTTTAAAAATCGAAGACAGAGGGACAGGGCGGCAGC
TGCCAAAAACAGGCTTCAGCATCACGGACTGGGCCAAAGC
AGTCTGCGCTCCATGTCAGAATCGGGCTGCACACCGCACA
GCTCGGCAGAATCCCCGTGCGCGGCCGCCAGTCCCACGAC
CAGCGTCTCCAGTATGAATGAACGAGGCGACGGTGGGACA
ATTCTCTCAGTTACAGACAGTGACTCTGATTTCGATGTAT
GATGCACCGTCGGACAAATATAAAACATTTTTTTGCCCAG
AGAAAAATGAACTTGTGAAAATGTGGGCAACATGGGGGCC
GGCCATTTTGCCAGCTTGTGTTCAACAAAAGGAGAAAAGC
ATGCTGTTTTTCCAGCGCTTCAACGGACTGACGCCCTTAC
CTTTTTATTTCCAAGGCCTATACACGACCATTTTGCATGT
TCATTTGTGAATATTTTGCAATTTTAAAAGGCATTTATGA
AGTGGAGTCCGAAAAGGTAGAACTCGATGCTCGATGAAAT
GAGTGAACCGGAGAGGCAATTTTATTATTTTGTGTTTATC
AGACAATCGTTGAAGTCCAAAAGCACCTTTATTCCCCCTC
GTCTTTTACTCGACTGGAGATGTTCATACTAATTTTATCT
CAAGATTTATATTGAATTGTCCATGTCTGATTCAAAGTTT
TCCTTAGGTCTAGGCTTGTCTAGATATGCTTGTATATGGT
ATCGCAATTACGCCACTCTCTTTCCTGCAAATTTCTTTAT
GTTGTGTCCATAAAGCGTGAGTAACTGTCTGTTAAGTGCT
TGGAGATTTTAAGTGTCTATTCATTCTGCTCGTTTTTATA
CTGTAAATGGGTTAATGGCGCTGAAAACACAGTGTTATGG
GTCACTTTTATGCAAATAAATATAATTTAATATAACGAC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations