ZFIN ID: ZDB-TSCRIPT-090929-8507
Transcript Name: six3b-201
Previous Name: six3b-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000025798 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000025798|OTTDARG00000020580|ZDB-GENE-990415-128 six3b|OTTDARP00000021208 six3b-001 LG_ CR932018.11 Danio rerio protein_coding KNOWN, 1759 bp
GTGATTGGCAGGGCTGCCATGACAACCACAGCACGACACC
AGGAAGACCAATAGAAAAGCGAAACAAAATGTTTCACCGT
TGCACTCTAAGTTGATTAAGGGTAGATATTCGCGCTCGGT
GGCACTGCGGCGATAGCAGCGCAAACACGACGTCGGGTTT
TCCGTCTTTCCCCGTCGTTTTGTCTCTGTCCGGCGACTCC
ATGGTTTTCAGGTCTCCTTTAGAGCTTTATCCCTCACATC
TTTTCCTGCCCAATTTCGCGGATCGCCCTCTGCTTCTGGC
GGGCAGCATTCCCAGAGCGAGGTCCCCGGAGGACTTACCG
ATGTTTCAGCTGCCCACCCTAAACTTCTCGGCGGAACAGG
TGGCCAGCGTGTGCGAGACGCTGGAGGAAACCGGGGACAT
CGAGAGGCTCGGACGTTTCCTTTGGTCGTTGCCCGTAGCA
CCCGGAGCCTGCGATGCCATCAACAAGCACGAGTCCATCC
AGCGAGCCCGAGCGGTGGTCGCGTATCACACGGGAAGCTT
CCGTGAATTATACCACATCCTGGAAACCCACAAGTTCACC
AAAGACTCTCATGGAAAGCTGCAAGCGATGTGGCTGGAAG
CGCACTACCAAGAAGCAGAGAAGCTGCGCGGCCGTCCCCT
TGGACCCGTTGATAAATACCGGGTCCGCAAGAAGTTTCCT
TTGCCACGGACCATCTGGGATGGCGAACAGAAGACGCACT
GTTTCAAGGAACGAACTCGCGGTTTGTTGAGGGAGTGGTA
CCTACAGGACCCTTACCCCAATCCGAGCAAGAAAAGGGAA
CTGGCACAAGCCACTGGACTGACTCCCACTCAAGTGGGCA
ATTGGTTTAAAAATCGAAGACAGAGGGACAGGGCGGCAGC
TGCCAAAAACAGGCTTCAGCATCACGGACTGGGCCAAAGC
AGTCTGCGCTCCATGTCAGAATCGGGCTGCACACCGCACA
GCTCGGCAGAATCCCCGTGCGCGGCCGCCAGTCCCACGAC
CAGCGTCTCCAGTATGAATGAACGAGGCGACGGTGGGACA
ATTCTCTCAGTTACAGACAGTGACTCTGATTTCGATGTAT
GATGCACCGTCGGACAAATATAAAACATTTTTTTGCCCAG
AGAAAAATGAACTTGTGAAAATGTGGGCAACATGGGGGCC
GGCCATTTTGCCAGCTTGTGTTCAACAAAAGGAGAAAAGC
ATGCTGTTTTTCCAGCGCTTCAACGGACTGACGCCCTTAC
CTTTTTATTTCCAAGGCCTATACACGACCATTTTGCATGT
TCATTTGTGAATATTTTGCAATTTTAAAAGGCATTTATGA
AGTGGAGTCCGAAAAGGTAGAACTCGATGCTCGATGAAAT
GAGTGAACCGGAGAGGCAATTTTATTATTTTGTGTTTATC
AGACAATCGTTGAAGTCCAAAAGCACCTTTATTCCCCCTC
GTCTTTTACTCGACTGGAGATGTTCATACTAATTTTATCT
CAAGATTTATATTGAATTGTCCATGTCTGATTCAAAGTTT
TCCTTAGGTCTAGGCTTGTCTAGATATGCTTGTATATGGT
ATCGCAATTACGCCACTCTCTTTCCTGCAAATTTCTTTAT
GTTGTGTCCATAAAGCGTGAGTAACTGTCTGTTAAGTGCT
TGGAGATTTTAAGTGTCTATTCATTCTGCTCGTTTTTATA
CTGTAAATGGGTTAATGGCGCTGAAAACACAGTGTTATGG
GTCACTTTTATGCAAATAAATATAATTTAATATAACGAC

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
six3b-201 Contained in:
OTHER six3b-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000025798 (1)
  • Ensembl_Trans:ENSDART00000077157 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AF030281 (1) 1722bp
    GenBank:BC059425 (1) 1629bp
    GenBank:AB004881 (1) 1253bp
    CITATIONS (2)