Transcript

ctslb-201

ID
ZDB-TSCRIPT-090929-8458
Name
ctslb-201
Previous Names
  • ctsl1b-001
  • ctslb-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000025742 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000025742|OTTDARG00000020540|ZDB-GENE-980526-285 ctslb|OTTDARP00000021162 ctslb-001 LG_ BX465840.13 Danio rerio protein_coding KNOWN, 1351 bp
AGCCAATAAGAGACCGCCTCTATGTTCGGACAGGCTATAA
AACACACTCAATTGTATGGAATTACAGTCAGTAAGGTTTG
CTTGTGAAAGTCCTCCAGGCAGGATGATGTTTGCTTTGCT
CGTCACGCTGTACATAAGTGCAGTGTTTGCTGCTCCATCT
ATAGACATCCAGTTAGATGACCACTGGAACTCCTGGAAGA
GCCAGCATGGAAAAAGCTATCATGAGGACGTAGAGGTCGG
GAGGAGAATGATTTGGGAGGAGAACTTGAGAAAAATTGAG
CAACACAACTTTGAGTATTCCTATGGAAATCACACCTTTA
AAATGGGAATGAATCAATTTGGTGACATGACAAATGAGGA
GTTCAGACAGGCAATGAATGGTTATACGCATGACCCCAAC
CAGACGTCACAGGGCCCGTTGTTCATGGAACCGAGCTTTT
TTGCAGCCCCACAACAGGTTGACTGGAGACAGAGGGGCTA
TGTTACTCCTGTCAAAGACCAGAAACAATGTGGATCTTGC
TGGTCTTTCAGTTCAACGGGTGCCTTGGAAGGTCAGCTCT
TCCGTAAAACTGGAAAGCTGATTTCTATGAGTGAGCAAAA
CTTGGTGGACTGTTCCAGACCACAGGGCAATCAAGGGTGT
AATGGAGGCCTCATGGACCAGGCCTTCCAGTATGTTAAAG
AAAACAAGGGGCTGGATTCTGAGCAGTCATACCCTTATCT
TGCAAGGGATGATCTGCCATGCCGGTATGACCCCCGTTTT
AATGTCGCTAAAATCACCGGATTCGTGGACATTCCCAGCG
GTAATGAGCTTGCCCTAATGAATGCTGTTGCTGCTGTGGG
TCCTGTATCTGTTGCTATTGACGCATCACATCAATCCCTA
CAGTTCTATCAGTCTGGCATCTATTATGAGAGAGCATGTA
GCAGTAGTCGACTTGATCATGCAGTCTTGGTGGTTGGCTA
TGGTTATCAGGGTGCTGATGTTGCTGGGAATAGATACTGG
ATTGTGAAGAACAGCTGGTCTGACAAATGGGGTGACAAAG
GCTACATCTACATGGCAAAAGACAAAAACAATCACTGTGG
CGTTGCGACAAAGGCCAGCTATCCCCTAATGTAAGGTCAC
TGGAGCCTTCTCTGCATTCTGAAAAAGACACGTTTATGGT
TTCTCTATTTTAATGTGTTTTTATTTCTTCTATTTTATCA
AGTTGTTCTGCTGTTAGGGCTATGATAGTGGTATTTTAGG
AAATTCCATTTTTCTTGTGTTTCATATATTTTGTTTATCC
AAGAAGAAGAATTTTGTACTGGATCTATTTGACCTGCAAA
TGGATAAATAATAAATTTTCTGGCATGGCAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations