ZFIN ID: ZDB-TSCRIPT-090929-8408
Transcript Name: txndc9-203
Previous Name: txndc9-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000025690 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000025690|OTTDARG00000020509|ZDB-GENE-030131-8569 txndc9|OTTDARP00000021117 txndc9-002 LG_ CR536604.6 Danio rerio protein_coding KNOWN, 735 bp
TTTTAGTTTTATTCATGTCTATATTCTAAAGGCTTTTACA
GAGGCTTGTACATGTGTAATTAACCCGATGATATACAATT
CATTGATTCATTTTATTTTGTGAATTATTGTATGGTTGAT
TAAAAAAGAATCCCAAAATCTTCTCTGTAAAATCTACGAA
CTAGTCTATATTTAATTAAATTTCTAATTGGCATATTTAA
ACATGACATTTTAGAAGAATTCTTAATGCATTTGATCAAC
TGGCAAAATAATGGTTAATTTTTGCCCTATTCATCTGCAG
GCTCTTGCCTTGAGAGTGTAAAACTGGTACTGGTTTAGTG
TAGAAAAGCATTTATGTTTTAATATCTTCTTTTTCACTGT
ATACTATTTTGAAGTGAAGTGTCATGTCTTGTCAAACACT
GCCATATCTGTAGCAGGCAGTGTGAGAGAAATGGCCAGTC
AGTCGATGGATATTGTAGCGAAGGCTCTGGAGCAGCAGGT
GCTTCAGTCAGCACGGATGGTGGAGGAGCAGCTGGATGCT
GAGCTGGAGAAGCTGGAGCGCATGGATGAAGACGAGCTGG
AGCTGCTGAAGGAGAGAAGACTCGAGGCCCTTAAGAAAGC
TCAGAAACAGAAGCAGGAGTGGATCTCTAAAGGGCATGGT
GAATACAGAGAGATCCCAAGTGAGAAAGACTTCTTTCCAG
AGGTGAAAGAAAGCAAAAGTGTGGTCTGTCATTTCTACAG
AGACTCCACCTTCAG

txndc9 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA txndc9-202 (1)    Ensembl 1370
txndc9-203 735
txndc9-204 (1)    Ensembl 817
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
txndc9-203 Contained in:
[BAC] DKEY-57A22 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000025690 (1),  Ensembl_Trans:ENSDART00000145431 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CK029351 (1) 780 nt
CITATIONS (2)