ZFIN ID: ZDB-TSCRIPT-090929-8407
Transcript Name: txndc9-202
Previous Name: txndc9-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000025689 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000025689|OTTDARG00000020509|ZDB-GENE-030131-8569 txndc9|OTTDARP00000021116 txndc9-001 LG_ CR536604.6 Danio rerio protein_coding KNOWN, 1370 bp
TTAAATAATAAATTTTGTACATTCTGAAATACGTCACAAA
GCGCTACGTGTGAGTGACGTAATCAGTCGACGCCTTTGCG
TGAAGCCCTGCGTCAGTGTGCCGCCTTTCAGAAATTATAC
AGCGTTGCAGGCAGTGTGAGAGAAATGGCCAGTCAGTCGA
TGGATATTGTAGCGAAGGCTCTGGAGCAGCAGGTGCTTCA
GTCAGCACGGATGGTGGAGGAGCAGCTGGATGCTGAGCTG
GAGAAGCTGGAGCGCATGGATGAAGACGAGCTGGAGCTGC
TGAAGGAGAGAAGACTCGAGGCCCTTAAGAAAGCTCAGAA
ACAGAAGCAGGAGTGGATCTCTAAAGGGCATGGTGAATAC
AGAGAGATCCCAAGTGAGAAAGACTTCTTTCCAGAGGTGA
AAGAAAGCAAAAGTGTGGTCTGTCATTTCTACAGAGACTC
CACCTTCAGATGCAAGATTTTGGACAAGCACCTAGCTATT
TTGGCTAAGAAGCATCTGGAAACGAAGTTCATCAAGCTGA
ATGTGGAGAAGGCTCCTTTCCTTACAGAGAGGCTGAGGAT
TAAAGTCATTCCAACATTGGCACTGGTGAAGGACGGCAAG
ACCAAAGATTATATTGTGGGTTTCAGCGATCTGGGCAACA
CCGATGAGTTTCCTACCGAAATGCTGGAGTGGAGACTGGG
CTGTTCTGACATCATAAACTACAGTGGGAATCTTCTGGAG
CCGCCAACAGTTGGACAGAAGACAGGGTCAAAGTTCACCA
AAGTGGAGAAAAAGACCATCAGAGGGAAAGCCTATGACTC
GGACTCTGAATCTGATGAAGATTAGAGGACTAAAACATCA
AGCTCCGTCTTTCTCAGGGCTTCCTACATAACAGTCCTAA
GTCTTGTGACACTGTGTTTTTAATTTGTGTAACACCACAG
TGTCTGTTTAATTTCCTGTCTTTGACCTTTACTCTTTATT
TGATCATTTCATGATGACCAAGCATTCACTGATAGTATAT
CACTACTTTTTGTTATCCCTTTAAGTTTACTGTCCGGAAG
TGTGCTCTTTCTGTTGAGCATAACTAGTGAAGAGTCAGTC
TCTGATTTATTTAATAATGAAGGTGAAGTTTCTAAAGGAT
GGAACTGTAAGCTGACATTTCAATGATGGTGCAAACACAA
ACATCCATATTTTTGCCTCTGACAAACTGATGCTCAGTTC
AGTGAACAGCAAACAAGTGCCAAGGAAGCAAATTTCTGCA
TTTCAGTAAGAATCAACACCCCTTTCTCCCATTGATGTGA
AGGAAGAGGAGGATTTTTCTTTTGCTAGCAGTACAGGACT
TAATAAAAAAAATATTTAATATGTGTGTTCTGTTCCTCTG
TGTAAAGATT

txndc9 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA txndc9-202 1370
txndc9-203 (1)    Ensembl 735
txndc9-204 (1)    Ensembl 817
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
txndc9-202 Contained in:
[BAC] DKEY-57A22 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000025689 (1),  Ensembl_Trans:ENSDART00000136902 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC045369 (1) 1333 nt
GenBank:CT672831 (1) 657 nt
GenBank:CO353141 (1) 253 nt
CITATIONS (2)