Transcript

txndc9-202

ID
ZDB-TSCRIPT-090929-8407
Name
txndc9-202
Previous Names
  • txndc9-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000025689 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000025689|OTTDARG00000020509|ZDB-GENE-030131-8569 txndc9|OTTDARP00000021116 txndc9-001 LG_ CR536604.6 Danio rerio protein_coding KNOWN, 1370 bp
TTAAATAATAAATTTTGTACATTCTGAAATACGTCACAAA
GCGCTACGTGTGAGTGACGTAATCAGTCGACGCCTTTGCG
TGAAGCCCTGCGTCAGTGTGCCGCCTTTCAGAAATTATAC
AGCGTTGCAGGCAGTGTGAGAGAAATGGCCAGTCAGTCGA
TGGATATTGTAGCGAAGGCTCTGGAGCAGCAGGTGCTTCA
GTCAGCACGGATGGTGGAGGAGCAGCTGGATGCTGAGCTG
GAGAAGCTGGAGCGCATGGATGAAGACGAGCTGGAGCTGC
TGAAGGAGAGAAGACTCGAGGCCCTTAAGAAAGCTCAGAA
ACAGAAGCAGGAGTGGATCTCTAAAGGGCATGGTGAATAC
AGAGAGATCCCAAGTGAGAAAGACTTCTTTCCAGAGGTGA
AAGAAAGCAAAAGTGTGGTCTGTCATTTCTACAGAGACTC
CACCTTCAGATGCAAGATTTTGGACAAGCACCTAGCTATT
TTGGCTAAGAAGCATCTGGAAACGAAGTTCATCAAGCTGA
ATGTGGAGAAGGCTCCTTTCCTTACAGAGAGGCTGAGGAT
TAAAGTCATTCCAACATTGGCACTGGTGAAGGACGGCAAG
ACCAAAGATTATATTGTGGGTTTCAGCGATCTGGGCAACA
CCGATGAGTTTCCTACCGAAATGCTGGAGTGGAGACTGGG
CTGTTCTGACATCATAAACTACAGTGGGAATCTTCTGGAG
CCGCCAACAGTTGGACAGAAGACAGGGTCAAAGTTCACCA
AAGTGGAGAAAAAGACCATCAGAGGGAAAGCCTATGACTC
GGACTCTGAATCTGATGAAGATTAGAGGACTAAAACATCA
AGCTCCGTCTTTCTCAGGGCTTCCTACATAACAGTCCTAA
GTCTTGTGACACTGTGTTTTTAATTTGTGTAACACCACAG
TGTCTGTTTAATTTCCTGTCTTTGACCTTTACTCTTTATT
TGATCATTTCATGATGACCAAGCATTCACTGATAGTATAT
CACTACTTTTTGTTATCCCTTTAAGTTTACTGTCCGGAAG
TGTGCTCTTTCTGTTGAGCATAACTAGTGAAGAGTCAGTC
TCTGATTTATTTAATAATGAAGGTGAAGTTTCTAAAGGAT
GGAACTGTAAGCTGACATTTCAATGATGGTGCAAACACAA
ACATCCATATTTTTGCCTCTGACAAACTGATGCTCAGTTC
AGTGAACAGCAAACAAGTGCCAAGGAAGCAAATTTCTGCA
TTTCAGTAAGAATCAACACCCCTTTCTCCCATTGATGTGA
AGGAAGAGGAGGATTTTTCTTTTGCTAGCAGTACAGGACT
TAATAAAAAAAATATTTAATATGTGTGTTCTGTTCCTCTG
TGTAAAGATT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations