Transcript

xpo4-002

ID
ZDB-TSCRIPT-090929-8390
Name
xpo4-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000025671 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000025671|OTTDARG00000020454|ZDB-GENE-030131-3062 xpo4|no_translation xpo4-002 LG_none BX936339.11,CR392366.4 Danio rerio protein_coding KNOWN, 719 bp
TTGTTGAGATTGTCAAACGTTGAATAAAAATTCACACTTT
AAAGCACTTCATGGGATCTTTAACATGCTTTTATTTAGCT
GCTCTTGTCAGTTGTTAGTTTTTATTTATTTATTTATTTT
TTATAAATGTGTGCTACTGTTCCTAATCTCTGTTCTCCTA
TGTTCAGTTTCCCTCTCTGTGTAACCAGTATTATAAGCTC
ATCACCTTCATCTGTGAGATTTTCCCAGAGAAGATCCCTC
AGCTGCCCGAGGAGCTCTTCAAGAGCCTCATGTGCTCCCT
GGAGCTGGGAATGACCTCGATGAGCTCAGAGATCAGTCAG
CTGTGTCTGGAGGCTTTGTCCCCATTGGCTGAACAGTGTG
CCAAGACACAGGAAAAGGACACACCCCTATTTATTGCCAC
GAGGCATTTTCTTAAATTGGTGTTTGACATGCTCGTGCTG
CAGAAGCACAACACTGAGATGACTGTAGCAGCTGGAGAAG
CACTGTATACACTAGTGTGCCTTCATCAGGCGGAGTACTC
GGAGCTGGTGGAGACGCTGCTGTCCAATCAGAGGGATGCT
CTGATCTACCAGCGGCTGGCGGACGCGTTCAACAACCTCA
CTGCCAGCAGCACACCGCCAACAATGGACCGCAAGCAGAA
GGTGGCCTTCCTCAAGAGCCTGGAGGAGTTCGTCGCCAAC
GTTGGAGGGCTCCTGTGTGTCAAATAAAGCAGTTCCTCC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations