Transcript

xpo4-202

ID
ZDB-TSCRIPT-090929-8313
Name
xpo4-202
Previous Names
  • xpo4-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000025587 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000025587|OTTDARG00000020454|ZDB-GENE-030131-3062 xpo4|OTTDARP00000021040 xpo4-001 LG_none BX936339.11,CR392366.4 Danio rerio protein_coding KNOWN, 4519 bp
TGCAGTGCATGGCGCGTCACTGAAGAACGACCATGATGGC
GGCGGTCGGTGCACCAGAAGTGATTTCACAGCTGGAAAGC
GCTGCCAAAGTTTTAATGGCACCGCCGTCCATGGTCAGCA
CAGAGCAGAGGCAGCATGCAGAGCACATATTCCTGTCCTT
CAGGAAGTCAAAATCCCCCTTTGCTGTCTGCAAACACATC
CTTGAGACGAGTAAAGTGGACTATGTGCTGTTCCAGGCCG
CCACCGCCATTATGGAGGCCGTGGTACGAGAATGGATCCT
TCTAGAAAAGAACAGCATTGAGTCGCTTAGAACATTCCTC
CTCACCTATGTCTTACAGAGACCCAATCTGCAGAAATATG
TTCGAGAGCAGATCCTGTTAGCAGTAGCAGTAATAGTAAA
GAGAGGCTCCCTCGACAAATCCATCAACTGTAAGAGCATC
TTCCTCGAGGTCAGCCAGCTCATCAGCAGCGGCAATCCCA
CAGTGCAAACATTGGCCTGCTCCATCCTGACAGCCCTGTT
GAGTGAGTTCTCCAGCTCCAATAAGACCAGCAACATTGGC
CTCAGTATGGAGTTTCACGGAAGCTGCAAGCGCATATTTC
AGGAGGACGACCTCAGGCAGATCTTCATGCTCACTATGGA
GGTCTTGCAGGAGTTCAGCCGGAGGGAGAACCTCAACGCT
CAGATGTCCTGTGTGTTCCAGCGCTATCTTGCACTGGCTA
ATCAAGTGCTTAGCTGGAACTTTCTTCCACCCAATCTGGG
GAGGCACTACATTGCCATGTTTGAAGCCACTCCAAATGTC
ATGCTCAAGCCCACAGAGTCCTGGAGGGAGTCTCTTCTAG
ACCACAGAGTCATGGACCTTTTCTTCACTGTGCACAGAAA
GATCAGAGAGGACTCGGACATGGCGCAGGACTCTCTTCAG
TGCCTGGCTCAGCTGGCCTCAATGCAAGGTCCCATCTTCC
CAGATGAAAGTGCTCAGGTGACCTACCTGGCCCACCTGGT
GGAAGGATTACTCAACATGATCAATGGTATTGAAATTGAG
GACTCTGAGGCCGTGGGCATCTCTAACATCATCAGTAACC
TCATCAGCACATTTCCTCGAAGTGTTTTGACTGCACTCCC
AAATGAACTCTTCGCCTCTTTCATTAACTGCCTCACGCTT
CTCACATGCTCCTTCGGTCGCAGCGCCGCCTTGGAGGAGG
TGCTTGATAAGGATGACATGGTGTACATGGAGGCATATGA
TAAGCTGCTGGAGTCATGGCTGACGTTGGTGCAGGAGGAC
GAGCACTTCCCCCGGGGCTGTTTCGTCCAGCCGGCCGTGC
AGGTCTTCAACTCCTATATCCAGTGTCACCTTGCTGCTCC
CGACGGCACCAGAAACCTGACTGCAAATGGTGTCGCTTCT
CATGAAGAGGAAGAAATAAACGAGTTGCAGGAGGACGACA
GAGAGCTGTTCTCAGATCAGCTGGCCAGTATCGGCATGTT
GGGCCGCATTGCTGCAGACCACTGTATACCTCTGCTCACA
GGATTGTTGGAGGACCGAGTCACGCGGCTTCATGGGCAAC
TCCAGAGACACCAACAGCACCTCATGGCGGCCGCGGACCC
TGATACGGTGGACAGAAAAGTTCTAGATGACCTTTACGAA
GACATTCATTGGCTCATATTAGTGTCAGGCTACCTCTTGG
CTGATGACCCTCAGGGTGAGACCCCCCTAATACCTTCAGA
AGTGATGGAGTATTCCATTAAACACTCAACAGAGGTTGAC
ATCAACACTACACTGCAGCTCCTCGGCTCTCCAGGAGAAA
AGGCCACTTCCATCCCAGGGTGCAACAGGACAGACTCTGT
TATCAGGTTGTTATCAGCGGTGTTAAGGACATCAGAGGTT
GAATCTCGGGCTACAAGAGCAAGTCTGACTCAACTCTTGA
GTCCTCAGATGGGCAAAGACATCGTCTGGTTTCTCCGGCG
CTGGGCAAAGACGTACCTACTGGTGGACGAGAAGCTCTAT
GGCCAAATCAGTATGCCTCTCAGCACAGCTTTTGGAGCAG
ACACTGAGGGAGCGCAGTGGATTGTTGGATATCTGCTGGA
GAAGGTGATCAATAATCTGTCAGTGTGGAGCTCTGAGCCT
GAGCTGGCCAATGACACCGTGGAGCTGCTGGTGACTCTGG
TGGAGAAGAGAGAGAGGGCAAACATCGTGGTGCAGTGTGA
AAACTGGTGGAGCTTGGCAAAGCAGTTTGCCAGTCGCAGT
CCTCCATTGCACATGCTGTCCAGCACAGTCCAGCGCACGC
TAATGAAGGCCCTGGTCCTGGGCGGCTTCGCTCACATGGA
TTCTGACACCAAACAGCAATACTGGGCCGAGGTACTTCAT
CCACTCCAGCAGCGCTTCCTGAACCTCATCAACCAGGAGA
ATTTTGCTCAGATCTGTCAAGAGGAAGCGGTGAAGCAGGA
GATCGTGGCCACGTTGGAAGCTCTTTGTGGCATTGCTGAA
GCCACGCAGATCGACAACGTGGCGTCTCTATTCAGCTTCC
TCATGGACTTCCTGTCCAGCTGCATTGGCCTCATGGAGGT
CTACAGGAACTCCCCTGAAACAGTCAACCTCATCATAGAG
GTGTTTGTGGAAGTGGCCCACAAACAGATCTGCTACCTGG
GAGAGACTAAGTCTATGAAGCTGTACGAGGTTTGCTTGAC
GCTGCTGCAGGTTTACTCCAAGAACAATTTGGGCCGCAAG
AGACTGGATGTGGCCGCAGAAGAGGACCAGTACCAGGACC
TTCTGCTCATCATGGAGCTCCTCACCAACCTGCTTTCCAA
AGAGTTTATAGACTTTAGCGACACCGATGAGGTGTTTCGG
GGGCAGGAGCAGAGCTCAGGTGCTGGACGAGCCGTATCGG
CTGCTGATGTTGTGCTGTATGGGGTCAATATTGTGCTGCC
CCTCATGTCTCAGGATTTGCTTAAGTTTCCCTCTCTGTGT
AACCAGTATTATAAGCTCATCACCTTCATCTGTGAGATTT
TCCCAGAGAAGATCCCTCAGCTGCCCGAGGAGCTCTTCAA
GAGCCTCATGTGCTCCCTGGAGCTGGGAATGACCTCGATG
AGCTCAGAGATCAGTCAGCTGTGTCTGGAGGCTTTGTCCC
CATTGGCTGAACAGTGTGCCAAGACACAGGAAAAGGACAC
ACCCCTATTTATTGCCACGAGGCATTTTCTTAAATTGGTG
TTTGACATGCTCGTGCTGCAGAAGCACAACACTGAGATGA
CTGTAGCAGCTGGAGAAGCACTGTATACACTAGTGTGCCT
TCATCAGGCGGAGTACTCGGAGCTGGTGGAGACGCTGCTG
TCCAATCAGAGGGATGCTCTGATCTACCAGCGGCTGGCGG
ACGCGTTCAACAACCTCACTGCCAGCAGCACACCGCCAAC
AATGGACCGCAAGCAGAAGGTGGCCTTCCTCAAGAGCCTG
GAGGAGTTCGTCGCCAACGTTGGAGGGCTCCTGTGTGTCA
AATAAAGCAGTTCCTCCGGCACCTGTCCACTTCAGCTACC
CCTCTCCAGCCCTCGTCCACACAGAGAAGCCTTTCACCAT
GCCAAACCATGGAGAAGCCGAGCGCCCGCCCGCTCGCCGC
ACAGGCCGGGACGCTCAGCCTCCAGAGAGGAGAGAGGCTG
GCGAAGGCTGAGAGCAGCGACCCGCCACGAGCATCTCAAA
CATGTTTACTTCACCACTGAGAGGTCCTCAGATGAACATT
CATGAAGTGCTGAGGGGTACTCTCTCTGAAAACGGACCCC
TTAATCCCCTTTATACTCACTCAAACACACAGTCCTTTGC
AGACGCTTCTCCTCGAGTGCCTTTCGGTTTCTCATGGCTC
AGATCCGGCAGTGTCCACAGAGACTAGTCGAACTGCGCTC
ACAGGATTGAGCCATGGATGCCATGAAAAGAAAAAGCCTT
TTCCAGTGGGACTTGGATTGCAGGAAGGCCCTTTCGGGAA
AAAAAAAAACCAAATCACTTTCGTGTGTAAGGGTGTATAT
ATATTTTCAAAAGCAGACAAAAATGAAAGTGTTTAAAAGG
ACTGAGCAGTTTTTATAAGACTATAGCTGACGACTTTCTG
ACTTTTTTATGACTTCACTGAAGGAAAAGGGGCTTGTTTG
AATTCTTCATTTTGATTGATTTGATTGATTGTAGTTTTAC
TCTTTCGCCGTTGTCATTTTGCCCTGATAACAGCCAGCAG
TATAACTCAAAGGGTTTTCAACATAGCTGACCCGATACGA
TGGGTGTTTCCACATGATCGCCTGTTGCTCCTGTTGGTTA
GTTGTTGTTTTTTTTAGACCATAATGTCAATGATGTTCAT
CTTACATTAGCGCACACACAGTTGTGGAGCAGTCAAAGTT
GCTGTAGCAATAAAATACCAAAAACGATGATGGAGGGATG
TCTGCTGTTTTATTCAGGGCATTTGATGGTCTTTATTTCC
ATTGTTCAAAGCACTAATTGTTATTTTGGAATGCCTGAAA
TGATCTGTAAAGTGTATATAAACTTGATATAAAAGCCGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations