Transcript

sele-202

ID
ZDB-TSCRIPT-090929-838
Name
sele-202
Previous Names
  • sele-001
  • si:ch211-260g14.8-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000006778 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000006778|OTTDARG00000006167|ZDB-GENE-041014-221 sele|OTTDARP00000006031 sele-001 LG_ BX296562.4 Danio rerio protein_coding KNOWN, 4369 bp
AAAAGTACAGAACTACAAACTACAGAAAGGACCATAAACA
GGACCACTGCAGAACATCACTGATAATGGACATTTGCAAC
AAGTTGCAGTTCTTTGCTTCGTTTGTTCTTATCTCTTCAG
CGCTAAACTTATGGAGATGCAGTGAAGGTTGGTCATACCA
CTACTCAGACTCCACCATGACATGGCAAAATGCCAGAAAC
TGGTGCAGGCAGCACTACACCGACTTGGTGGCCATCCAGA
ACAAAAATGAGATTGCTCACCTCAACGGAATTCTTCCAAG
ACGCAATGGCTATTACTGGATTGGTATTCGTAAAATTAAT
AACCAGTGGACCTGGGTGGGAACTAACAAAACACTTACTG
CTGAAGCTGAAAACTGGGCAGAAAAGGAGCCCAACAACAA
AGGAAATAATCAAGACTGTGTGGAAATATATATTCAAAGA
GAGAAAGATGAAGGTAAATGGAATGATGAATCCTGCTCAA
AATCAAAGACAGCGTTGTGCTACACGGCTTCCTGCGCGAG
TGACTCCTGTGTCAGTGGTCATGGAGAGTGTGTAGAAACC
ATAAACAGTCATACATGCTCATGCTTTGAAGGCTTCTATG
GAAAAGTATGTGAAAATGTTGTTAAATGTGAACCAAATGA
AGTCAATGCATTGGATCATTCTAGTAAGCAGTGCTCTCAT
CCTCATGGAAACTTCGCATATGACTCTCAGTGTGAATATT
CATGTGAGGAGGGTTATGAACTGAAGGGTTCCAGTACAAC
GAGATGCAATTTTACAGCGGAGTGGACAAGCAAACCACCA
TCTTGTGAGCTTGTTCAATGCCCACAGCTGAACAAACCAC
TGAAAGGTGGCATGCAGTGTAATCATCCGATGGGTCAGTT
CAGCTATCAGTCCAGCTGTGAGTTTGTGTGTGATGAAGGA
TACAAACTGCGAGACTCCAGCTCTTCTACTCTGATCTGTG
GAGCAACGGGACACTGGAATGATTCACAGCCCACTTGTGA
AATAGTAAAATGCAAAGCAAAGGATATCACCCCACCAGCT
CATGCTAAAGTCCACTGCACTAATGAAGATATACCCTATA
AATCTCAGTGTGAATATTCCTGTGAGGAGGGTTATGAACT
AAAGGGTTCAAGTACAACAACGTGCACTTCAACAACAGAG
TGGTCAAGTGAACCAACAACCTGTGAACTTGTTCAATGCT
CAGAGTTGGCCAATCCACAGAAAGGTGGCATGCAATGTAA
TCATCCGATGGGTCAGTTCAGCTATCAGTCCAGCTGTGAG
TTTGTGTGTGATGAAGGATACAAACTGCAGAACTCCAGCT
CCTCTACGCTGATCTGTGGAGCAACGGGACTCTGGAATGA
TTCACAGCCCACTTGTGAAATTGTAAAATGCAAAGCAAGG
GATCTCACCACACCAGCTAATGCTAAGGTCCACTGCACTA
ATGAAAATATACCCTATGAATCTCAGTGTGAATATTCCTG
TGAGGAAGGTTATGAACTAAAGGGTTCAAGTACAACAATG
TGCACTTCAACAACAGAGTGGTCAAACGAACCACCAACCT
GTGAACTTGTTCAATGCCCAGAGCTGGCCAAACCACTGGA
AGGTGACATGTATTGTAATCATCCGATGGGTCAGTTCAGC
TATCTGTCCAGCTGTACGTTTGTGTGTGATGAAGGATACA
ATCTGCGAGACTCCAGCTCCTCCACTCTGATCTGTGGAGC
AACGGGACACTGGAATGATTCACAGCCCACTTGTGAAATT
GTAAAATGCAAAGAAGAGGATATCACACCACCAGCTCATG
CTAAAGTCCACTGCACTAATGAAGATATACCCTATGAGTC
TCAGTGTGAATATTCCTGTGAGGAGGGTTATGAACTAAAG
GGTTCAAGTACAACGACGTGCACTTCAACAACAGAGTGGT
CAAGTGAACCAACAATTTGTGAACTTATTCAGTGCCCAGC
CCTTGATAATCTTGTCAATGGAGATCTCAGCTGCAATTCA
AGCTTTAGTTATGGGAGTAAATGCAGCTTCAGTTGTGCAG
AAGGATTCATTCTCCAGGGAGCTTCAGAGATCAGCTGTAC
AAATACAGCAGAGTGGAGTCAGAAACCACCTCACTGTGAA
GCTGTGGTTTGTCCTCAACTTTCTGACCCAGCAAATGGGT
ACACAAACTGTTCATCTGATGAACCCTTCTTTGGCACCAT
CTGCAACTTCATCTGTTTTGATGGCCACCAGCTTGACAGT
AATGAGACAGTGATGTGCAGCCATGATGGGAGATGGTCAG
GGGAAGTGGCGGTATGTCAAGCTCAACCTGGTCCCTCTAA
ATCGCTCTTCAAAGCAACAGAAGTGGCTCTTGGCGTTGCA
GGAACTGTCGGCAGCTCCAGTCTGTTCTTAGTCTACTGGA
TACTGAAGAAACTGAAGAGTAACGCTAACAAGTTTAAACT
GAACAGCACTTTGGATACTGTGGATCCACCGCAGGCTTAT
AAGAGCAGTATTGACAGTCTCCTATAGAGCAAAAGTGCTT
CAAACTACACTGATCTTATATGGCTGTAGTGGAAACACTT
CAGAAGATATTCTTTATCCAGTATGATGGGCATTTTCCAT
GCAGACTGCAGTCCCTAAATTAATGTGATTTCTACTTCCC
AATGGAAGCATTATTTACTTGAGTTGAACATATTGTTCTT
TACTGTTTAACCCTCTGAGGATGTTTTGGGGGGGACAAGA
GGAGTTCTGAAGTGCCCTGACACTTGTGCTTTTATCAGTT
TCTTATGAACATATAATTTGCTAAAGTCTATTAACACTGT
AAACAGCACAAAGTGAGCTACAATATTTTAGCAATATTTA
TGTACATGATTGTGTTGTTGAAAAGGAAACGTTTATGCAT
GGTTGGTGAAAATAATAAATGTTGAAGTCACTGAAATAAC
TCCATAAAACACATACATAATTTTGTAGCCTAGAGCTTTT
GCTTCAAAATTATGTGATCATATTGTTTGTTTGTTTTCAG
GAAACAATAAATTGATTTAAGTCAGGGGTATCCAGGCTCA
GCCCTGGAGGACCACTGTCCTGGAGAGTTTAGCTCCAACC
CAAATTAAACACACCTGAACCAGCTAATCAAGCTCTTATT
AGATATACTAGAAATTTTCTGACAGGTGTGTTGAAGCAAG
ATGGAGCTAAACTCAGCCGGATACTAGCCCTCCAGGACCA
ACTTGGTACACCCCTCAATAAAGTGAAGTTTATTTATAAA
CTAATTTCGAGAGGATCATGTGCTTATGATTGTCCACAGC
TGGTCCAGCATTGGCTAATACATGATTCACCAATCAGATG
ATTCCTAACCTGCTATAAATAACCAAAATGTCTTACCTCA
GTATCTTCGTTTTGAAGAATCCCTCCTCCCACCCCTACTC
CCCCTCCTTTCTAGATTGGGCACTGTTGCCTTACAGCAAA
AATGTTACTGGTTAAAGTCCCAACTGAACCAGTTGACATT
TCTGTGTGGAGTTTGCTTGTTCTCCCCGTACTTGCATGTG
TTTCCCCTGGGTTCCTCCCACAGTCCTAAATTGAACATTC
TAAATTGGTATCATAGTCGAACGCTTAGTAAGCCATATAT
CTCTCTTTAGCCATTCCTTTATTTGTTATTAGCCAGAATT
AAGTTGGGGGAGTTCATCTAGATCTACCTGAGCTCAAACT
CCCCTCTAGCTCTGTTAATGGGAGGGAGCCCAGGGCTCGA
GGATCTTATAAGCTCAGAGCTCTCTACAGGGACAGCATGC
CAAATAAGCTTTTTAATCAATCATCAGCTAAATGTGAACT
TCTGAAATATTCTAAGAAACTTTTTGGGTGGAAAGGATCT
ATGCGAGGAGATCATGCAGTGATTCACACCTGAGAAGACA
AATACTTGCATAATGAGTTGCATAATGGACCATCCAGATA
GGTAGATAACTGAGAGGGGAGAGTCATAAGAAAGACTGTG
AGGAGGACAAAATAAGTTTAAAATATTTATATACATTTAT
GATGTTTTAGTTTACTGAGAATATCAATAGCTTTCACACA
AAATAACTTGATATGCACTTTGAGTGCAGTTTAACGCTTT
ATTGTGCATATTGTTTTGTTGTAATTATGAATAGAAATAT
AGGCCCTTTACGGCTGTGTTTTTCTTATCAGGACTAAAAA
AATGAGAGTATTTTAAGCTCCTTTTTTGTCATCACATAGA
AAAGTGCTAAAACACATATAGCCTATACATTTGCCAACCC
CAGGGAGTGTAATATATATTTTCATATTAATTCTGTGTTA
AAGAAAACATTTTTGTACTATTTATTTAGCAAAAACTGTA
GCTGTCTGATTACTATTTGTAAAGTTCAATAAAGTTTTGC
TTTCATTGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations