Transcript

ap4s1-203

ID
ZDB-TSCRIPT-090929-8365
Name
ap4s1-203
Previous Names
  • ap4s1-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000025645 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000025645|OTTDARG00000020483|ZDB-GENE-030616-404 ap4s1|OTTDARP00000021081 ap4s1-002 LG_ BX324186.12 Danio rerio protein_coding KNOWN, 774 bp
GAGAATAGTTGACAAAGTCTGCTGGCTTTCATTGACAGAT
GCGTCCCGTGACACAATAAATCCGCAACAAACAACTATTA
GATCTGCTTCTGTGATCGTGGTGCTGTATCACACCTCTGA
GTCACTATGATCAAGTTCCTGCTGATGGTGAACAAACAGG
GGCAGACTCGCCTCTCTAAGTATTATGAAGCAGTGGATCT
TGGGAAGAGAGCAGCTCTGGAGGCTGACGTGGTGCGTGGA
TGTCTGGCCCGGAGGAAGGAAGAGAATGAACTCTCTATCT
ATGAACTTGTGCACAACTTTGTGGAGGTGCTAGACAAATA
TTTCAGTCGTGTGAGTGAGCTGGATATCATGTTTAATTTA
GACAAAGTACACATTATTCTTGATGAAATGATCCTGAACG
GACACATCGTGGAGACCAATAAGAACAGAATACTGGCACC
ACTACTGGCCCTGGACAAGATGACTGAAAGCTGATCTGAT
GTTAATGACCAGTCATCATTGCTTTGCTACAAATAAATGT
GTTTTTCTTTGTGTCACCATTCTAAACCTCATCCTGTTTT
TTCACAAATTGGTTTTATAATAATAATAATTAAAGCTGCA
GGCAGCAATAAAAGGGACCTCGCACCCGGGCTCACCCCTG
CCCGGTGGCCTAAGGATGACAGAGAATTATATACATTTAA
GATAGAAAAAAAAATTATAACCTGAGAAAATCACAGATTT
ATGTTAAACCTTCTATCAGCAGGTGGCGCTATAACTGTAA
CTCAATGTTGGCAT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations