Transcript

ap4s1-201

ID
ZDB-TSCRIPT-090929-8364
Name
ap4s1-201
Previous Names
  • ap4s1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000025644 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000025644|OTTDARG00000020483|ZDB-GENE-030616-404 ap4s1|OTTDARP00000021080 ap4s1-001 LG_ BX324186.12 Danio rerio protein_coding KNOWN, 711 bp
CCCAGTAGATGGATCAATAAAAAAAGCGACCCATACGGAC
GCCATATTGACCAAAACAAAATGGCAGAACAAGAGAATAG
TTGACAAAGTCTGCTGGCTTTCATTGACAGATGCGTCCCG
TGACACAATAAATCCGCAACAAACAACTATTAGATCTGCT
TCTGTGATCGTGGTGCTGTATCACACCTCTGAGTCACTAT
GATCAAGTTCCTGCTGATGGTGAACAAACAGGGGCAGACT
CGCCTCTCTAAGTATTATGAAGCAGTGGATCTTGGGAAGA
GAGCAGCTCTGGAGGCTGACGTGGTGCGTGGATGTCTGGC
CCGGAGGAAGGAAGAGTGCTCATTTGTAGAGTATAAGGAC
TATAAACTGGTCTATCGCCAATATGCAGCTCTTTTCATTG
TTGTTGGCGTCACTGAAAATGAGAATGAACTCTCTATCTA
TGAACTTGTGCACAACTTTGTGGAGGTGCTAGACAAATAT
TTCAGTCGTGTGGTAAGTAGTGAGCTGGATATCATGTTTA
ATTTAGACAAAGTACACATTATTCTTGATGAAATGATCCT
GAACGGACACATCGTGGAGACCAATAAGAACAGAATACTG
GCACCACTACTGGCCCTGGACAAGATGACTGAAAGCTGAT
CTGATGTTAATGACCAGTCATCATTGCTTTGCTACAAATA
AATGTGTTTTTCTTTGTGTCACCATTCTAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations