ZFIN ID: ZDB-TSCRIPT-090929-8282
Transcript Name: tbx15-002
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000025551 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000025551|OTTDARG00000020433|ZDB-GENE-020529-1 tbx15|no_translation tbx15-002 LG_ BX255950.8 Danio rerio protein_coding KNOWN, 2486 bp
GAGACGTAGAGAAGTTGGAAGGAGACGAAAAACATTGAGC
TATATTAGCAAACTGTCTTCTCGGACAAGGTTTTGAGCCG
TAGTCCGTACGTTGAGAATGGGTTCTTTTATTTTTAAGCC
TTTACAAGGCATACATTAGACTTGGGCTTGGATTACCGTC
GTCACCGGAGACCTAAATCCACCCGTTATAAACATTTTGC
GCGTGCGGCATTCTTGCGCTGCCGCCCGGACGGAGTTTCT
ATTCGCCCTTCGTTGGATTTGCAGTGGGAGAGATGAGTGA
CAGGAGACGGTCCGCTGCTGCGCTGAGTTCACGAGCGCAC
GCCTTCTCGGTTGAAGCCCTGATCGGGACAAACAAGAAGC
GGAAGCTTCGTGGCTGGGAAGAAAAGGAGCTGGAGCTGTC
TATGGAGAGCCTCGCGAGCAACGGACAATTGGGAGACGGA
GAGGATCCCGCTAATTGTCTGGATATCGACCCTGATTCAG
AGGCCAGCCCGGGCTCTGACGGCGAGGGTCTGGCGGAGCG
GACGTCCTGCTCGTTCGGCTCCCCGGCGGACCTGACTTCC
GCCGCCTGCGACCCCTCACCATCAGCCTCTATGGAGGAGA
TCCAGGTGGAGCTGCAGTGCGCTGACCTGTGGAAACGCTT
CCACGACATTGGCACAGAAATGATCATTACAAAAGCTGGA
AGGAGAATGTTCCCTGCTATGAGGGTAAAAATAGTGGGAT
TGGATCCACATCAGCAGTATTACATTGCCATGGACATTGT
ACCAGTGGACAACAAGAGATACAGGTAAACACTACTTAAA
TGAGTGTGAAGCAATTTGACTGGGCATTTGTATACACTCT
GGAAAAGTGATCCCTCTTGAAATGAGCTGGGAGATTTACA
CGAGTAAGCAACGGTGACTGTAACCCTGACAGAGTTGCCG
TATCAGCACTGAAGTTGGTGTAATGTAACCCTATGATTTC
GCTCTCACCATGACAACCTTCCATCACACACGCGTAGAGA
CAAGGGTTACTTAAATGCAACTAAAGCCTGCATGTCCAGC
CTGCTGCAGTGCACTTGTCCATTTCATTGCAAGTCATGCA
TGTCAGATTATGTTCGTTTTATTTAATAGTAAAAGGACAT
AATGATCTGCTAGATTAGCTCTCCTTGCTTCTTCCTGCAA
TCACTAAATCGGCAAACGCATCTGATTTTTGTTTGTATCC
TGTGAAAGTATTTGAGCTGTGTTTATGCTTTAGTTCCACA
TGCTGATGTATGAGAGTAGAAGTGGAAACGGCTGAAATCT
GAACTCTGTTTTAGGGAATAAGAGGCCATGAATAAGGATA
TTATGTTCATAGTCATACACGAGTGCATCAGATCTGTTTT
TAAAGTTGTTTTAAGTCTGCTGGAATTAATGCATAGATCT
CAATGCTTTAAAGACAATAAATGCTTGAAACGAAACAAAA
AAACAATGCACAACATTGTGGGTGTTATTATGTTAATGAA
TCAGTGTTTGTGACAGCACAATAATCTTCAAGGTCAATTA
CTCTTAGATTAATGTATGCATTTACTGAAAACGAAACCAC
AACGGATTGAGCACTGGCCTTGAAGAGAGCCATTTAGAAC
CCCCAAATATCATGGAGGATTTTAGAAGCCAGAAGATCTT
GTAAAATTAAATAGGATTTTCTTCCTGGCTGGGGAATTTA
CCACAAGGCTTTGCAAACGGAGCAAAGAGCTGTCACTGGA
ATGCCTCATGTGTCTCGAGGGCTCGGGTCTGGAAACGCAG
CCTTTATTGGAATTTACTCACTTTACTTAGGCCCGCTGCC
CTTTTCAAGCGACACAGAGTTTGTACTAGACTTGTTAAAT
CTTTCTTTACGTGTTACTTGAATTACTCTACTCTTTAATG
TGGGCATTCGGTATGGCTTATATTTGAGAGAAGAAATAGG
AAAGTGCAGAGCGGCCCAGATTTTGGATCTGTTGCAGACC
CTCGCCAGCTAATTTATTCACAAATATCCTGCATGCGCTG
GCTGCCGTTTTTGTTTCTCCATTTAGATGTTGGCCTGTTT
GCCTCACTTTTTTTTTCTTTGTCCAGCTGTCTACTTCAGG
CATGCCAGTCCTCTCTCTTATTTTATATATGCACTCTAAT
ACACACAATAAACGCACATGGTGCAGAGCACATGCTCTAG
TCCACACTTCAGGGTATCACTTACTCTGTCAGTATAAGAA
ACTCAATATATGACTTGGTCTATTTGCTGCCTTGTATAAG
AGAGCACAAGCATATCTACACTACACTATGCTGTAAAAAG
TGATTAGTTATTACTTTACTGAAAGAAAAGCTGAGTAAAT
TGATTAAACAATTATTTCTAACTTATAATTGTTAAGCTAA
TTTTCATAATCTTGAACACATTAAAAAAATGCTGCAAAAC
TGCTCATTTTAAATGAGCTGAAATATGACAATTCTTTAGT
TTTTTTGGGACAACTTGTCACAGCTTAATCAAAAAAAAAA
AAAAAA

tbx15 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA tbx15-002 2486
mRNA tbx15-201 (1) 3026
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
tbx15-002 Contained in:
OTHER tbx15-002 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000025551 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC054920 (1) 2497bp
    CITATIONS (1)