header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-8275
Transcript Name: barx1-201
Previous Name: barx1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000025544 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000025544|OTTDARG00000020430|ZDB-GENE-050522-28 barx1|OTTDARP00000021004 barx1-001 LG_ CR548622.8 Danio rerio protein_coding KNOWN, 1430 bp
ACTCAGTTGGTGCGGTAAGAACAGAAACAGGCTGCCCTCA
CTGGGCGGATCAGACTTCTCACTCCAGCTGCGTGGACGGG
ACCACACATTTCGGAACTCCCCGAAAGAAAAGAGAGAAAT
TCACTTGCACTTTAAGAGTTTAAAGATCGAGCGTCAGTCA
AAAGTTCTCCACAAACGCGAGGATATTTTTTTAGATGATC
ATGGCATCTAAAAATCTGAATGGACGTTTATGCATGGGAA
AATCGTAAAATCTGAATCCTCAATGTGTCCTAGGGCTTTC
ATCAGGCTACCAGGAGGTTCGGAGAGCATCTGCCACATTT
AAGCTCTAATAATGCAACATCCTTTGGAGATTGGGGCGCA
CTATTACCCCCCGGATGCCCATCTAGACCAAAGGTCTCAC
AGGTACAGGAGTTTCATGATCGAAGAGATTCTTACAGATC
ATCCGGATCAGAAGGTATCAAGTCCCACCGGAGACCTTCT
AAAGTTTGGAGTGCATGCCCTTTTGTCCGCCAGACCTTAC
CATAACCACTTAGTTCTGAAGGCAGACCAGACGGGTATCC
TGAAGTTTCCGGTGTCTCCTCTGTCCTGCTCGCTCGGGGC
GCCGCTAAGCTCTGCGCTTCTGTCCGGTGCCGCGGGTCTA
CAGGTGGGCTCATCATCCCATCATCTTCCGCTGGACCTCC
ATCTTCGGGGTAAACTCGATCCTGGAGCTGATGCAGTAAG
CAAGACAAAGAAAGGAAGAAGGAGTAGGACAGTATTTACT
GAACTACAGCTGATGGGTTTGGAAAAACGATTTGAAAAAC
AGAAGTATCTTTCAACCCCTGACAGAATAGATCTGGCAGA
GTCCTTAGGCTTGAGTCAGCTTCAAGTGAAAACATGGTAT
CAAAACAGAAGAATGAAATGGAAGAAAATTGTGTTGCAAG
GAGGTGGACTAGAATCTCCAACCAAACCCAAAGGCCGTCC
AAAAAAGAACTCCATCCCCACCAGTGAGCAGCTGTCGGAG
CAGGAGAGGACACGAGAAGCGGACCGCTTATCCGACGGTG
GAGCTTCTTCACTTTCTGATGCAAACCAAGAGGAATAAAC
GGGATAGATTATCCCGATCCGTGCGAATGCGATTGTCTCT
GGGACGCAAAATCGGCCTCTTTGGATGATTGCGCACCGAT
GCCTTTATGTTGGCACTTACACAAACTTAACCACTTGGTT
TGATTTTATACTACCTGTTTGTCTGTTTGTTTCATTATGG
CAACTTTTGCGGGCCTCAAAAAGTCACAGTGAACTTTTCC
AGGGACCGAGTGGTGATTAGCGAATGGACTTTCAGGATTG
AAGGCTGTGGTATCATGGACTTTTTAATCAGCATTATTTG
TGCTTTTTTATGTTTTTCATTAGAATTTAAAGAATATTCA
AAAAATTATTAAAATGCCAATTTTTTCGAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
barx1-201 Contained in:
OTHER barx1-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000025544 (1)
  • Ensembl_Trans:ENSDART00000023889 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC095353 (1) 1461bp
    GenBank:AY596188 (1) 1004bp
    GenBank:DQ499478 (1) 649bp
    CITATIONS (2)