ZFIN ID: ZDB-TSCRIPT-090929-8274
Transcript Name: phf2-201
Previous Name: phf2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000025543 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000025543|OTTDARG00000020429|ZDB-GENE-050302-10 phf2|OTTDARP00000021003 phf2-001 LG_ BX601648.8 Danio rerio protein_coding KNOWN, 5745 bp
CTTTCTCTCGTCCCGGGAAACCCTAAGAAGCAGCCGCAGC
GTTTAATGAGCTCCATTCATCTGGACCAGCATGACCGAGG
CGATTTTTCCCGTCTTGTAGACTGACGTAACAATATTACA
ATGAAAGGATGCATTTTCTTGGGCTTCACGAGAGTCTCGG
AGCTCGTATAGTCACCAGGGGGCATGAACACGTCAATGCA
GCGCGGGAAACATTTTAACATCGCAACGTTGTAACGTCGG
ATCTGAGGAACGGTCGAATGGACGCAGGAGCAGCTCCGCG
GCTCTTCGTATCGCTGTAGTTTGTGTTACGGGAGGTTCCT
GCTGCCCCCATCCATCTCTCCGGCTGTTGTTGTGAATTGA
TCTAACATGGCGACTGTACCCGTGTATTGCATCTGCAGAT
TACCTTACGACGTAACCCAGTTTATGATCGAATGCGACGC
CTGCAAAGACTGGTTTCACGGCAGCTGTGTGGGAGTGGAT
GAAGATGAAGCACCAGATATTGACATCTATCACTGTCCTA
ACTGTGAAAAAACCCACGGCAAATCCACCTTAAAAAAGAA
AAAGAGCTGGAATAAGCATGACACGGGGCAGAGCGGAGAC
GTCAGACCAGTTCAGAACGGCAGTCAGGTGTTCATAAAAG
AGCTACGCAGCAGAACATTCCCCAGTTCAGAAGATGTGGT
GGTCAAACTGTCTGGAAGTCAGCTGACATTGGAGTACCTT
GAGGAAAATGGCTTCAACGAGCCAATTCTCATCCAGAAGA
AAGATGGTTTGGGGATGGCCATGCCCGCACCCACGTTTTA
CGTCAGTGATGTGGAAAACTATGTTGGGCCTGATGTTCTT
GTGGATGTCGTTGATGTCACCAAACAGACAGACAGCAAGA
TGAAGTTAAAAGAGTTTGTTGATTATTACTACAGCACAAA
TAGAAAGAAAGTATTAAATGTGATCAACTTGGAGTTTTCA
GATGCAAGAATGGCCAATATTGTCGAGAGTCCGCAGATAG
TTCGGAAGTTATCCTGGGTGGAAAACTACTGGCCTGACGA
TGCGCTGTTGGGGAAGCCCAAAGTGTCCAAATACTGTCTC
ATCTGTGTGAAAGACAGCTATACAGACTTCCACATCGAGT
GTGGAGGAGCCTCTGTGTGGTATCACGTACTCAAGGGAGA
GAAAATCTTCTTCCTGATCAAGCCCACGTCTGCCAACCTT
TCCCTGTATGAGCGCTGGAGATCCTCCTCCAACCACAGCG
AGATGTTTTTTGCTGACCAAGTAGACAAATGTTACAAGTG
CACACTCAAACAAGGGCAAACTCTATTCATTCCTTCAGGA
TGGATCAATGCAATACTCACTCCTGTAGACTGCTTAGCCT
TCTCTGGGCATTTTGTCCACAGTTTAAGCGTGGAGATGCA
AATGAGAGCATATGAGGTGGAAAAAAGACTCAAAGTTGCC
AGCCTCACTCCATTTTCAAACTTCGAAACAGCGTGTTGGT
ATGTGGGGAAATACTACCTGGAGCAGTTTAAAGGTTTACA
CAAGGCGAACAAGCAGCCACCTCCTTACTTGGTACACGGT
GCCAAAATTGTCAATGGAGCATTCAGATCGTGGACTAAAA
AACAGGCTCTTTTAGAACATGAGGACGAGCTTCCAGAAAA
CATGAAGCCAGCACAGCTCATTAAAGACCTTGCCAAAGAG
ATTCGGATTGCAGAGGTGAAACAAGTCGTCAGTGACTCTC
AAAATGCGACAAAAGCCATAAAAAGTGAACCCAGCAACTC
AAAGCCCCCGGCAGAGGAACCTCCGTCTGCTCTGTCAGAA
CCAGAAGAGCCCATGTCCCCTGCCCACGTCTCCAGCCCTT
CAGGAGATAAGCCAGCCAGGAAGAAAGTCCCAAAGCCACC
CAAAATGCCCAAGGCTCCAAAACCACCGAAGGAACCCAAA
ATAAAAGAGGGAGGCAAAAAGAAGGCCAAGAAAGTGAAAG
AAGGTGTTATACCTGAGAAAAAGCCCTCGAGTCTGGCAGC
TCTTGAATCCCATGCAAAGGACATCCTGAACAAGATGGAC
CAGCCCAAAAAACTGATTAAAACCGGGATGAGTATCATGG
AGAAAGAGACGAATAAACCGAATGACGTCAAGAAGTTTGA
GATGATCCGAGAGCACAATAAGAACAAGACGGAGTCCAAA
TGGAAATATAAGAACAGCAAACCCGATTCCTTATTGAAAA
TGGAAGAAGAGCACAAATTCGACAAAAGTCTACTCAGCCA
TAAAGACAACAAATTTGCATTTTCGTTATCGAATAAGAAG
TTGCTGGGCTCAAAGATGCTGAAGACCCAGACCAATTCCA
GTGTTTTTGGCTCGATACAGAACATTAAAGAAGAAAAGCC
CAAGCCTGTGAGAGACGAGTACGAGTACGTCTCTGATGAA
GGAGAGCTGAAGATTGAGGAATTCCCAATCAGGAGGAAAA
AGAACGCAGTCAAGAGAGAGTTTTCTTTTTTATCAAACAT
CAAAGAGCCAATTCAGCCATCAAAAAAGCCAAAGCTACCG
CCGTCGGACATGAAGAGTCCAGATACATCGGATGAGGAAT
CGCTTCACATAGACACCGAGGCCAAGACAGACGTCAAAGG
GCGCAACTCAAAGGTCTCGAAAAAGAAAGGTGGCAGTTCA
GCTGGGATCCTGGATCTCCTGCAGGCCAGCAAACAAGTGG
GCGGCATTGACTACAGCAACAACAGTCAGCCACCTGCATC
CCCCAGCACACAGGAGGCCATCCAGGGCATGTTGTCCATG
GCTAACCTGCAGTCATCGGACTCTTGCCTGCAACCCTTCT
GGAGCAATAGCCAAGCTAAGAACAACTCGCACAGCAGCGC
AGCCAGCAAGAAGCCGAGCGGTGCGGCCGGAGCAGGAGGG
AACAGCAAACGACCTGCTAAACGCTTGCCCAAAAAGACCC
AAAAGAGCAGCAGCGTGGACAGTTCGGACATGTTCGATGA
TGACCAGGACCATCTGGAGGCTTGCTTTAAGGACTCGGAT
TATGTTTATCCGTCTCTGGAATCAGAGGAGGACAACCCCA
TTTTCAAATCGAGATCGAAAAAAAGGAAAAATACAGACGA
CACTCCATACAGTCCAACAGCTCGAGTTGGGCCCACTGTG
CCGCGGCAAGAGAGACCAGCTCGGGAAGGGGCACGTGTGG
CATCTATAGAGACAGGACTGGCAGCCGCAGCAGCTAAATT
GTCGCATCAGGAGGAGCAGAAGATCAAGAAGAAGAAAAAG
AGCGCCAAAAAGAAGCCCATAGTTGCAGAGGAGTCTCACA
AACTCTCTCATGACAGCAGCTCTCCAGAACCCACTCCAGA
CTCCGAGAGCAACATGGCCGATCACGAATACAGCACTGGA
ACGGGCAAAAGCGCCGGCGGCTCGCAACCCATGGCCCCCG
GAGTCTTCCTCAGCCACAGACGGCCTTCATCATCATCGTC
ATCTCAGAATGCCTCATCAGTCCTGCCAGCAAAAGTCGAA
CGAGGGAACTCGACAGATTCCAAAGCCAAGAGGCTAAAGA
AAGGAATGGCCACCGCCAAACAGAGACTTGGAAAAATCTT
AAAGATTCACCGTAATGGCAAACTCCTGCTGTAACACGGA
CAATGAGGGCGACTCAGACTTTCTCCTGATGTTTATGGAC
CCTCGGACTGATCCCTCCCTCTCTCCCTCCATGAGACTGA
AACAGACGGGAGGACGCGGAGTAAAAAAATCATAACGGAT
CCCACAAGTTTTCAATTTCTAAGAAGAACATAGCTCAGAT
AGGTTTTTGCCTCTTTTACTTTATAACTTTCAGATATTAA
AAAATGTACAGAATACCTGCTATTAATATTTTGTAAGAAG
ATTTTTGTCTTGTTTTACTACGGCTATCAGTTTTATCAGG
GGTTGCTAATATATTATAAGATACATAGCAGTCATTCCAA
GATAAAGAAAGTATCCCCTGCATGTATTCCAGTTGCATGC
ATTATAATTTTGAAGGGGGAAGAGTTTGCTGGAAGGTTGC
ACACGGAAAGTTCATTACTGCTTTTTGGATGTGGCTTATC
ATTCATTTTTTTAAACAACTATTTCTAAACATATGATGAT
ATTCAATAACTTCCCGAGTGATTTTGATTTAGATTTTTAC
CCTTTTAAGTTTCCTTAAACAAAAGAGATGAACCGACAAC
ACAAAAAAAACACGGCTAAATAAAAAGAGTACTTTTCTGT
TTGCAAAGCACTATCACAGATGATATTTATTGACTTAATA
TAATTTTTCATGTCATAGGTAGATTTGAAAAAGCCAGAAG
GCACTTACAAAACATCAGTGAAGCACAAATAGGAATTAGT
AAAGCGGCTTTATGTTGTTATTCTTATTTTATTTACTAAC
ATAGGAAAAGAAATATGATTTTGTGATGAAAAAACGTCGA
TTTTTATATATTGACGGATTATTAAACACACATATCAATA
TCAAACCATATTTCCAGTAAGTTTCATGTCTGAAATATTT
AATTTCAGCCATACAAAAGTTACATTTTATTTATATTTAT
ATATATATTTTTTTAGACATTGATACTACAATCAATCGCA
TGTCATCCTGTTTTTCGCATTATGTTATTGTTTGACAATG
TAGCTCTTATTACAGTTCCATACGAAACACTCGGCCCAAA
CAAAAACAGACAAGGTAACACTACATCAATGGGATCTCCA
GCACTGATGATAAGCCTCATCCAGGACATTTCACTACATG
GGGATACTTTCTGTCTTCTGTTTGTTTCACAGGCAGCACC
AGTTACCCTAGAATGAAATATGCATTTATATTGCTTCACA
GTACAGTATGTAGAATGTAGCCTGTATATAGCTTTTTAAA
TGACTACTTTTTGTATCCTTTTTTTTCCTCCTTAATACTT
CATTATACATTTTTACTAGTTTTTGCTAATTACAGACGGA
AAAATATATATAAAGATATAGAAATAGTCAGTACGTTTAA
AAATTAAATGTTTTCGTTTGACACAGAATACCAGATTTGA
TTTAATCATTTCTTTTTTTTTTTTTTTACAATTGTTTTGT
TTCATTCTGTTACATTAGACAAAAGGTGTTGCCTGGAGAA
CAAAATAAACAGTGTAACATTTATTCTCATATGGCCTTAC
ATGCATAAAACCATGTGTATTATGATTCATTTATGATGGG
GAGAAGAGAGAAAAAAAATCAAGTTTCTACGACCAGCCTG
ACATTTGAGCTAAAATACCCCTGATGGATTTTAAAGTTAT
TTTACTAGCACCTTGTGAAGTGTTTTCTGTGTCAGTGATG
TAATTTATTAATGTTTGTAGCCTTTTATACTTGTATAATT
CTTAAGAGGTTTTCTTTGAAATATTTCATCAGTCTGTGAG
CCCCTTAGGACACTTCTATCATTAACATTGGGCAATAGTT
CCTTTTATTTTTTGTCTTAGCAAAACCATATGTCTTTATC
GTTTTCATCAAATCAAGTGCAACTGCTCATCAATACGAAA
TGTTACATCGTTATTATTATTATTATTAAGCAGCTATTTT
AAAGATCCATTCTATCATGCCATGAGTTTTATTTTTGGTA
ATAGAGTATGTACATTCTTAACCAGGTTTACTGTGCTCAT
AAATTGCAGTGTTTTAGTTACCAATGTAAATCTTGTATCC
ACCTTTCCCAATCGAAACACTCAGAATCTTTGTCAATGGA
ACTATTTCAGGTTTTTATTTGTACAAAATGTGTGTTGCTT
TGTTGTGGTTTATTTTTATATGTTC

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
phf2-201 Contained in:
OTHER phf2-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000025543 (1)
  • Ensembl_Trans:ENSDART00000045942 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC060927 (1) 2915bp
    CITATIONS (2)