ZFIN ID: ZDB-TSCRIPT-090929-8269
Transcript Name: arpc5la-201
Previous Names: arpc5l-001, arpc5la-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000025537 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000025537|OTTDARG00000020425|ZDB-GENE-040426-1453 arpc5la|OTTDARP00000020998 arpc5l-001 LG_ CR354441.11 Danio rerio protein_coding KNOWN, 1425 bp
ACTATGCTGTGTAATTCCGCTTCCGCCCCAGTCGGGATTT
TCGTCCGCTCTGCAGGAATGTGTGGTGGAGATGCTCGGGC
CGGTGGAGAAGGAACAGCCGCACCTTCCTGCTGACAGATG
AACCTTCGACCGGCGGCGGCCCGTGCCTGAGGGAAGCGGA
CACACGCGCGCACCCCACCCGTCCCGCCACCGCGCTTTCC
CGGACTCCCCCAACCGATAGATCGACTGATTAAAGCGGCT
CCTCCTCATGGCGAAAAACACCCTGTCCTCACGGTTCCGG
GGAGTCGATATCGACGAGTACGACGAGAATAAATTCGTGG
ACGACCAAGACGAGGCGGCCGAGCAGCAGGGACCGGACGC
GTGTGAGGTGGACGATCTCATCAGGCAAGGGGACATGATG
ACAGCATTTCACATCGCCTTGAGGAATCCACCAATCAACT
CCAAGAATCCAGCAGTGAAAGAGCGGGCACAGGCGGTGGT
GTTACGAGTGCTGACTGCATTTAAAAGCAGCGATATTGAG
CCAGCGGTAAAGTCTCTGGACAAGAACGGAGTGGATCTGC
TGATGAAGTACATCTACAGAGGCTTCGAGAAGCCCACAGA
CAACAGCAGTGCCATCCTGCTGCAGTGGCATGAAAAGGCT
TTCGCTGTGGGGGGCCTGGGGTCCATTGTACGAGTGTTAA
CTGCAAGAAAATCTGTCTGAGAAGCTGGACGAATGGGAGT
GTTAACCAGCCACGGGATTTCTTAGACATGGACAACTTCT
CCTCTCTCACAATTTAACCTTATCTGGGGGAAAACCACTC
ATGCCCAACCGCCTATTTCACGAAAAAATACTGTATGATA
TTTAATGTAAATTATTGATTCTTCAATATGTTATTATGGA
AGACACTACTCGACTTATGAAGGTGAACGATTGTGCGACA
GTCTGTGAACTGCAACAGAAGGACGGTGATGAGACTTGGC
TTTATAAGCCTTGAGCTGCAGTTTCAGGACATTAAATACT
GTGATTAATATGAAAGTTGTATTTGCTTGTTCTTAGTTGG
CACTCTCGGATGTGTAGTTCTCATTTTTTTCAGTTCCAAC
TCTCATTTTTTTTCTTATTGTACAGAAAGAGGATAATGTT
TAATATATATAGTATTTAGGTCAGGGGTCACCAACCCTGT
TCATGGAGAGCTACCTTCCTGCACATTTCAGTTGCAGCCC
TGACCAAACACACCTGTTTGTAATTATCAAGTTCTGCTTT
AGGTTCTATTAATTGGTTCAGGTGTGTTTGATCAGGGTTG
GGACTGAACTCTGCAGGAAGATAGCTCTCCAGGAACAGGG
TTGGTGACCCCTGATTTAGGTGGTGAAATTTTGGTTCAAC
TCGTAGTGTGGGGTTGAGTCGGGTTATTGTGAAGTGCCTG
GTGCAATAAAGGACATTTAAGAGTG

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
arpc5la-201 Contained in:
[BAC] CH211-152P23 (1)

Genome Resources: Vega_Trans:OTTDART00000025537 (1),  Ensembl_Trans:ENSDART00000061144 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC065664 (1) 1395 nt
GenBank:BC056697 (1) 1256 nt
GenBank:CO919529 (1) 771 nt
GenBank:CT702887 (1) 544 nt
CITATIONS (2)