Transcript

ren-002

ID
ZDB-TSCRIPT-090929-8238
Name
ren-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000025504 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000025504|OTTDARG00000020406|ZDB-GENE-040630-3 ren|no_translation ren-002 LG_none BX537348.8,CR550308.6 Danio rerio protein_coding KNOWN, 768 bp
CTTTGGTCTATCATGTTTGGCTGAGTTTCATAAATAACGT
CTGAAGAGCGAATGGAATGATTGAAAGCTGATGTTGTTTT
TTCTTCTATCGTCAATGTGGTTAATTTTCAGTGTAGAAAA
GTGTTTGTTTCTTTTAAGTGTGAAGTTTGGTGTCAGTTTT
GCCAAATGGTGCAGTACAATGTGTTCCTTGTGTGGCTTTT
AGGCTATCATTCACCTTTTCTCTCTTTTTTGTTGTATTTT
CAGTATACAGTGAGCTGTAATGTGGTCAGGTTGTTGCCCA
CTGTTGCATTTCATCTTGGTGGTCAGGAATATTCACTCAC
AGATGAGGACTATATTCTCTGGCAGTCAGAGTTCGGGGAG
GACATTTGTACTGTCACGTTCAAAGCATTGGATGTGCCAC
CCCCTACTGGTCCTGTCTGGATACTGGGGGCAAACTTCAT
AGCTCGGTACTACACAGAGTTTGATCGGGGAAACAATCGC
ATTGGCTTTGCACGAGCTGTCTGACAAGCGCTTGGTTTTC
TGCTATTCTGAAAGTCGTATTGTTTTAACTTTAACACAAA
CCATAGGTCATATCAATGACAGATTACAGCTTTCATTTAG
AAAAAAGAAGTGCACTTTAGCTTTACTTTTTTATCACTCA
TCACAAAAATAATATATTTTGAAACAGTATATTTAAGTGT
GAACTGAACATAATCCTTCAGGGGATTTAGGCTGTGTTAT
TTACAATACAACTGATATATATATATATATATATATATAT
ATATATAT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations