Transcript

nkx2.7-201

ID
ZDB-TSCRIPT-090929-8218
Name
nkx2.7-201
Previous Names
  • nkx2.7-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000025482 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000025482|OTTDARG00000020393|ZDB-GENE-990415-179 nkx2.7|OTTDARP00000020960 nkx2.7-001 LG_ BX004845.5 Danio rerio protein_coding KNOWN, 1176 bp
GTCTAATAGCAGCGGAAAGAGCAAGATACGAGGCGACTTA
TGCAAGGAGATAGCCCACGACAGACTCTAAGGAAGAAGAT
TCTGCTTAATTGTGTAGGCCTGCAGTAACTTTTCAAAGTC
ACCTGATGCTGCTTTGAACTTGACAAGGTGAAACGGAGAA
CATTTCTTCCACGTTTCTTCAAGCACGCGCACGATGCTTC
CGAGTCCTGTGACCTCCACTCCGTTTTCGGTAAAGGACAT
CCTGAAACTGGAGCAGCAGCAAGCGCTAAACCCTGGGGTA
TTCATGGGTGTTGAGCAGGACTCTGTGCCGCTGCAGTCGC
TTCAGCTTCAGTGTATGCAGAACACCCTGAGTCGGAGTCT
GGATCTCCTTTACAGCCCGGAGAAAGGGATCCCCGGAGAA
CAGGTGAAATGCGACGACTTTGACATCGTCAGAAGCTCAT
GCGGATCTCCAACGGAAGAGGAGATGGATGCAAACGAAGA
AACAAGCATGTGTCCATTTACCGACTCCAGTTACAGCAGT
AAAAACGGCGAGACACTCCGGGAGAAACCGAAGCAGAGGC
TGCGCAGGAAACCGCGGGTGCTTTTCTCCCAAACTCAAGT
GTTTGAGCTGGAAAGACGCTTTAAGCAGCAGAGATACCTT
TCGGCCCCGGAGCGTGACCACCTGGCTCTTGCACTGAAGC
TCACATCCACACAGGTCAAAATTTGGTTCCAGAACCGGAG
GTACAAGTGTAAGAGACAGCGGCAGGATAAATCCCTGGAG
CTGGCCGGCCCGCGGAGGGTGGCGGTGCCTGTGCTGGTGC
GCGATGGCAAACCCTGTCACGGAGCTCCGTACAATGTCAC
AGTATCATATCCCTACAATAACTATTACAACAGCTATGGA
AATAACCCATACCACTGTAACTTCACTTCTGTGCCATCAT
TTGCCAACACGAGTCAAATACCCAATCACTTTGTGGACAT
GAATCTGACAACGGGAAGCGTTGATAGCATCAGAACTTGG
TGAGACATCAGAGAAGAACTTGGATTAAAGACTCTTTTAT
CAAATGGCACTGGACTGGAGGATTTAAGAAACACTGTCAT
TTGCTTTAGATTGTTGACTAATTTTATATAAATATATATT
TGTTTTTATATTTGTGGTTTACAAAACAACACCAAATAAA
GAATTAATATTTAATA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations