Transcript

ncs1b-201

ID
ZDB-TSCRIPT-090929-8194
Name
ncs1b-201
Previous Names
  • freqb-001
  • ncs1b-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000025455 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000025455|OTTDARG00000020377|ZDB-GENE-050930-1 ncs1b|OTTDARP00000020942 freqb-001 LG_ BX548021.6 Danio rerio protein_coding KNOWN, 2070 bp
AACAAGACAGGGAGGGAGTAAAAAGACGGAGAGAAGAGGG
AGGGCGAGTGTAGAGCCAGAGAGAATTGGCGCTTAAGTGT
GAGCAGGAGAGAGCACACAGAACACGGCGAGCGTCTCTTA
TAACCACTGGCATTTAAATACATTCAAAGCCTTATTTTTT
AAATTGAAGAACCAAACAGATCACGATCAAAATCTGACAC
TATTGCTTCAGCATTCAACGAAACGCATGGGCTTTTATTT
GAGGAGCAACAGTTCTAAAGGACTCGTCAGAGGTGCTAGT
TATTGAGGATGGATTTTTAAGAGTCTTGCTTTGTGAAAAG
GATTCTAATAGTGACTTTAGACCTTTAAAGGGCTCAGTAA
GTCAGCAAGAACACGAACATTTATGCTGGATGGATTTTCT
TGGATTTGTTGGCAGTGCTGATTTGTTTGTCACTTTGTTG
GTGCTTTTAAGTCTCTGAAATTCTGCCATAAGGAGAAACG
AGCTGCTGAAGGGCTCAGGTACGGGTCAGTTTCACACTGG
ACCACACAAACTGTATCTGGAGGAGGTCTGGCGATCATGG
GCAAATCAAACAGCAAGCTCAAACCGGAGGTGGTGGAGGA
ACTGACCAGAAAGACCTACTTTACAGAAAAGGAGGTTCAG
CAATGGTATAAGGGCTTCATAAAAGACTGTCCAAGTGGTC
AGCTTGATGCTGCAGGCTTCCAGAAGATCTACAAGCAGTT
CTTCCCCTTCGGTGACCCCACCAAGTTCGCCTCATTCGTC
TTCAATGTTTTTGATGAGAACAAGGATGGACGAATTGAGT
TCTCTGAGTTCATTCAGGCGCTGTCTGTGACCTCACGTGG
GACTTTGGATGAAAAGCTTCGCTGGGCCTTCAAGCTTTAT
GATCTTGATAACGATGGCTATATCACTCGTGATGAGATGC
TCAATATCGTTGATGCCATCTATCAGATGGTGGGAAACAC
AGTTGACCTTCCTGAAGAAGAAAACACACCAGAGAAAAGA
GTGGATCGCATTTTTGCCATGATGGATAAGAATGCTGACG
GGAAACTGACCCTGCAGGAGTTTCAGGAGGGATCAAAGGC
AGATCCTTCTATTGTACAAGCTCTGTCGCTTTATGATGGC
CTGGTATAGTAGCAGCTTGTCTAAAGGAGACAGGTACCTC
AGAGGATCCAGTGCCGTGCCATCCCACAGTGCCATGAAGG
AGATGAGTCTGACCTCTCTATCTGGACATTTAAGACTAAG
GGAGAAGAATTCATCCTCATCTTCTCAACTCAAGCAAATC
ACATTTCAGCACTGAGAAAGAAAACAAGAGACATGTCATC
CTGAAAGTTGTGGGTGTATGTATGTGTGTGTGAATGCTGT
ACTACAGGATCCCATGGGATTTTCACAAGTGCACTGGAGA
CTGAAGATGGCACTGATTGTTCAAGCATGCTGAGAACCCT
AAATTATACATGTAAATATGTGTAAACATTTCATATTTTT
TAATCATACCTGGCTGGGATGTTGTAAATGTGCTCTTCAT
ATATAATTTAACAGACTGCTGATATTTTATTTATTTATTG
CTTACCTTGAAGTGTATGGATTGCTGCTGTCACGAGCCTC
AATGTTTCTAAAATCCTCTTGGAGTGAAAGACTTTTTAAT
CTGTTTTGCTCTTTCTTTGGAACTGTGAATGTGGAAGGAG
ATTAATTTATTATATCCGCGGTACGCAGCTCCCATCGTGA
AGAGTGAGCAGTCTATTCTTTGCTGGCAAAACTCATTGTG
AAGTTTTCAAGCTAAACAAGACACTGTAACAGAGCGACGT
ACAACACTGTTATTCCAGATCAGCCTCAACTGCTGTAAGT
ACCTCTGTAATGGAGAAACAAACAGTCCTGCATCTGCTAA
GCTTAAACTACACTTCTGCCTTTCTGTCTTTCCTGTGTCG
TTTTCCTGTCACACAAAAGCCATAGACTTGAACTATGACA
TTCTCCTTTCGAAGCAAGTAATGTGGGTATGTGCTGGCTG
GGGTTTGAAATGCGTCTCATGCTTTATCAGTCGCTCTCTG
GCTGAAGATTAAACTTGAGTCACTGCATAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations