Transcript

optc-201

ID
ZDB-TSCRIPT-090929-8188
Name
optc-201
Previous Names
  • optc-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000025445 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000025445|OTTDARG00000020373|ZDB-GENE-030131-1798 optc|OTTDARP00000020936 optc-001 LG_ BX530015.9 Danio rerio protein_coding KNOWN, 1427 bp
GCCTTCCCAATCTTGGGTTAGATTCAATACTCAATCCTCA
GGAGAACACAAGGCCAGCTTCCACACCTCTTTTCCCGCAA
GAGCTGCTTTTGGGCTATGGTGATTCAAAGACAAACATCA
AAGATGTTGCTGTATCTTGTTTGGATTCTTCTGGGCTTCA
GTCTTGGTGCCCCTCCAACTGATTTGGATCTTGAAGCATT
TGGCCTGGAGAATTATGATGACCCAGACTCATGGGATCTG
CACTATAATTATGATGATGAGCATGAGGAGGTTGAGACAG
TAGCTCCTCCTACAGCTCTCACTCCTCCACCTGCTGTGGT
TGTTCCTGAAAACTATGTGGAGGAAATGACTCTGCCACCT
CGTCCCACGAAATCACCTGTTCCTTCAACTCTAGACTTCA
AAGCACCAGGCCTGTTTGGACCTGACACAGGCTTAGGGAT
GCCCACATGCCTTCTGTGTGTGTGTATCAGCGGCAGCGTT
TACTGCGATGACTCAGATCTGACTCATATTCCCCCTCTTC
CCAAAGAAACCACACACTTTTACGCTCGCTTTAACAAGAT
CACAGAGATCAAAGCCGCAGACTTCATCAATCTCAATCAG
TTAAAACGGATCGACCTTAGTGGAAACCAGATTGGTAAAG
TGAACGAGGATGCTTTTCGTTCACTGCTTCAACTTCAGGA
TCTCATGATGGCTGACAACAACATCCAGGCTCTTCCTGAA
CTCCCAGCTTCCCTCAAGCACATCGACATCCGCAATAATA
AGCTGAGGAGTTCAGGCATGCATGCTGAGGCCTTCAAGGA
AATGAAGGAACTTCAATTTCTTTACCTGTCACACAACAAG
TTAGACTACATTCCCGTACCCCTACCCGAGAGCCTGCGAG
TGCTCCACCTGCAGAACAACAACATACAGAGCATAACCCA
AGACACATTCTGCAACAGCCATGACAAGAACTACATACGG
AAAGCCCTGGAGGACATCAGGCTTGACGGCAACCCGGTGG
ACATCAATCTTTACCCCCAGGCATATTTCTGCTTACCACG
ATTACCTGTAGGAACTCCAGTCTAAAACAGTGTCTCTCTC
TTTTCAACAGGCTACGGAATAATAATATGAAGCGAGGAAT
TGAATTAGTTTAAAATGTCACCCAATCAATATCTAGGAGA
AAGTTTTTAGCTTAAGTTTTCTTTTTGCAAGTCACTCTGT
GCGTTATGACTTTGCACTTTGCAGGATGTACAAATGTTTG
TGTTCCAAAATCTACTCCTTACCTACACTCAGATGCTAAC
TAAAATCCCAATTTACAGAGCTCAGCATAATTGAGTACAC
CCTATTTTGAAAATCAATATTTTTATTTATTTCTCAGAGA
ATGTGGGTAATATATATTGGTGCATTTGAACAAAACAGGT
TCATTAAACAGATATATTTATTAAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations