Transcript

sox8b-201

ID
ZDB-TSCRIPT-090929-8119
Name
sox8b-201
Previous Names
  • sox8-001
  • sox8b-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000025373 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000025373|OTTDARG00000020320|ZDB-GENE-031114-1 sox8b|OTTDARP00000020874 sox8-001 LG_none BX470259.9,FP074880.6 Danio rerio protein_coding KNOWN, 1902 bp
CGCAGCTCAGTCAGAAAAACACCGGGGTCGTGTGAGATGA
TGCGCCGTAATGATAATTGAAGCTTTCTGACTGGACAGGT
GCTTAATTACTAAACAAGCTGAGTTTGAAAGCATAAGCGA
CTATGAGCGAGGAGCGGGAAAAGTGCAGCAGCCCGACCGG
GTCCTGCAGCTCCGAGTGTCCGGATGAGTGCGACTCTGAC
CCGTCCTGCTCTCCAGCAGGACCCGCCGCGCTCCGGATGG
GTCAACAAGCGGAGGATGAGGACGGCAGATTTCCGGTGTG
TATCCGGGACGCGGTATCGCAGGTGCTGAAGGGCTACGAC
TGGTCTCTGGTGCCCATGCCGGTGCGGGTGAGCGGATCCG
GGAAGAGCAAACCGCACGTCAAGAGACCCATGAACGCGTT
TATGGTTTGGGCTCAAGCCGCGCGGAGGAAACTGGCGGAT
CAGTACCCGCACCTGCACAACGCGGAGCTCAGCAAAACAC
TCGGCAAACTCTGGAGACTGCTGACGGAGAGCGAGAAGAG
GCCGTTCGTGGAGGAGGCAGAGCGACTGAGGGTTCAGCAC
AAGAAGGATCATCCGGATTATAAATACCAGCCCAGGAGAC
GGAAGAGTGTGAAGCCGGGCCACGCCGAGTCTGAAGCCGG
CTCCGAGCTGATGCAGCACATGTATAAAGCGGAGCCGGGA
ATGGGTCGACTGACTGGGTCACCGGACCACATCACTGACC
ACACAGGTCATACTCACGGTCCACCGACTCCTCCAACCAC
CCCCAAAACAGAGCATCCTCAGGCCCCCAAACAGAACATT
GACTTCAGCAACGTGGACATCTCCGAGCTCAGCACGGACG
TCATCGGCAACTTGACCTTTGACCTGCAGGAGTTTGACCA
GTACCTGCCTCTGACCCCAGATCAGGGCGCCTGCAGCCGG
AGGGCGCCCCCTGCTGGAGCACACCTGCACCCACAGCGAG
TGCACATAAAGACGGAGCAGCGGAGCCCGCAGCACTACAG
TGAGCACAGCAGCACGCTTTACAGCAGCAGCAGCGCACAG
TGTGAATACACAGAGCACAGCTTCTACAGCCCGTACTCCA
GCTACCCGTACCCATACCCATACCTGCACAGGCCCATACT
CAACATCCCCGCACCGCACAGCTCCTCTGCACACTGGGAC
CCCCCCGTCTACACCACTCTGTCCAGACCCTAGACCACTG
GGGCTCAGGGACAGCATTTGCTGAAGGGCTTTGTGCCAAA
ACAACCACATCATAAAGAGGGATGCAATGAAGAGTCGGCC
GTCAGAAACACTACTGGGCGAAAACGCATTTTAGGGACAC
AGAATTGAGCTGTTCAGCTGTAATGATCACTGTAATGAGG
GACTGCATTTGCCCAGCAGCAGCATTTTGAGAGGGTTCGC
CAAGTTCAGCAGGCAAACATGGTTTTGGACTAAAGAGAAA
CATGTTTGTAGGAGCTGATGATAGGGTTGTGCTGTACTGC
ACTGCTCAGCACGCTGGTTTCACTCAGCTGTAGACACGGG
CTGTGTTCAAAATCACATACTTCACTACTACATAGTATGT
GAGCTGAGGAGTATGTCAGAATTAATAGCATTGGATCAGT
AGGCGAGTCTTAAAAATAACACATTTACAACACAAAGTTC
TATACATGCACAGCACAGTTCACATCTACAACACCAAGTG
TGTACACTCGAAAATACACAAGTGCAGTTCCTTTAAAACA
TTTCATGAATATGCAAATCCAGTTTGTAAATTAAAAATAA
TTCACAAATCTGCAAATCCAGTTATTAAATTTAAAACTAT
TCCTAAAGATGCAAATCCAGTTCATAAAAAATAATTCATA
AATATGCAAAGCCAGTTCATAAATATAAAAAAAATCTTAA
ATATTCAAATCCAGTTCATAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations