Transcript

kcnd3-201

ID
ZDB-TSCRIPT-090929-8064
Name
kcnd3-201
Previous Names
  • kcnd3-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000025315 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000025315|OTTDARG00000020282|ZDB-GENE-030131-5626 kcnd3|OTTDARP00000020829 kcnd3-001 LG_none BX927185.16,BX664742.15 Danio rerio protein_coding KNOWN, 3065 bp
TGCGGGAAGTCACTTCGAGCGCGCGAGCGGTCGGTGCGGC
ATTTCACTCCGTCCGAGCAAAATGGATCATTAAACAGCGC
AGGATGTGACTGAGGGACACATAAGCAACTAAACTCTTAT
TTTTTGCGCCTCCGGTCACCCTGGTTATACCACAAATATT
GTATTCTTTCACGTGGGTTCTTGTTTGCCTTTCTTCATTA
ATGTGCGGATTTTTCGGCGAACACTTTCGAAGTGATGTCA
GGAGGAAATGTGACAAATATAGCCGAATGAATGAAAAGTT
AAAAGATTTTTCATGGATGGGGTCTAATCTAATGTCAAGC
TGGTTGTGAAGGTGTTTGATCTGGTCCCCTCGACCCCATC
CGGAGTCCCCATGGCTGCAGGAGTAGCAGCCTGGCTCCCC
TTCGCTCGGGCGGCGGCCATAGGATGGATGCCCGTGGCCA
ACCTGCCTATGCCTGTTGCACCATCCAATAAGAACAAGCG
ACAGGATGAGCTTATTATCCTCAACGTCAGCGGGCGACGC
TTCCAGACATGGCGGAACACGCTGGACCGATACCCCGATA
CACTCCTGGGGAGCTCAGAGAAAGAGTTTTTTTTCAACGA
GGAGACAAGGGAGTATTTCTTTGACAGAGATCCAGATGTG
TTCAGAAGTATTCTTAACTTCTACCGCACAGGGAAGCTGC
ACTACCCACGTTACGAGTGCATCTCTGCCTACGATGAGGA
GCTGGCGTTTTTTGGAATCATTCCTGAGATCATCAGCGAC
TGCTGTTATGAAGAGTACAAGGACCGCAAGAGGGAGAACA
CTGAGCGTCTAATGGATGACCTTGAGGACAACAAAGACAG
CAAACTCCCTAACATGACTTTCCGTGAGACCATGTGGAGG
GCCTTTGAGAACCCGCACACTAGCACCATGGCACTAGTTT
TCTACTACGTAACCGGATTCTTCATCGCCCTGTCCGTCAT
CACCAACGTGGTTGAGACGGTTCCTTGTGGTTATATGCCA
AATCAGAGGGACGTCCCTTGCGGGGAACGCTACACTGAGG
CGTTTTTCTGCATGGACACAGCTTGTGTTATGATCTTTAC
AGTGGAGTATCTGATGCGACTGTTTGCGGCGCCCAGCCGG
TACCGCTTCATGAGAAGCGTGATGAGCATTATCGATGTGG
TTGCCATTTTACCATATTACATCGGGCTCGTCATGACCAA
CAATGAGGATGTGAGCGGAGCCTTTGTCACACTACGGGTG
TTCCGCGTCTTCCGGATCTTTAAATTCTCCCGCCACTCCC
AGGGTCTCCGAATCCTTGGCTACACACTGAAGAGCTGCGC
CTCAGAGCTTGGCTTCCTCCTCTTCTCCCTCACCATGGCC
ATCATTATCTTTGCCACAGTCATGTTCTATGCTGAGAAAG
GCTCATCGTCCAGCAAGTTCACCAGCATCCCGGCCTCCTT
CTGGTACACCATTGTAACCATGACAACACTGGGGTATGGA
GACATGGTCCCGAAGACCATAGCAGGGAAGATCTTTGGCT
CCATCTGTTCCCTCAGCGGGGTGCTGGTCATCGCTCTGCC
TGTTCCTGTCATAGTTTCCAATTTCAGCCGCATCTACCAT
CAGAACCAGAGAGCTGACAAGCGCAAGGCTCAGAAAGTTC
AGAAAGCCAGACTGGCCCGAATGAGAATTTCCAAGAGTGG
CAGCTCTACCGCCTTCCTGCATAGCAAACGAAACGGACTC
AACCAATCACTGGAGCTAACGGGATCCTTAGAAGAGGACC
AGCAACTGAAAAAGACCACATCTCTGTTGGAGAGTCAGCA
TCACCATCTTCTGCACTGCCTAGAGAAAACCACGAATCAT
GAGTTTGTGGACGAGCGTCTGTATGAACAGGGCTATTTGC
AGACAGCACTGCAGAACTTCCCGTCGCAGAGCCCGTCTCT
CTCCAGTGAAGAGGGCATCACAGGCACCTGCTGCTCTCGA
AGACCCAAGAAGAACATTCAGCCTCTCAATGCCACACACA
CGCACTCACACACACACAATCTGCAGGAGCTCAGCGCATT
GCACATCCAGTGTGGGGAGCAGCAACCACTGAACACCAGT
CGTTCCAGTCTCAATCTGATGTCGGATGAATCAGGGAGTC
TGAACTGCAAGAGCAGTGGACTGGTTACAACGGCCATCAT
CAGTATCCCGACTCCTCCCTCAAACAACTCTCGAGCCAGT
CCCGACGCCCCGTCCCCTCCCAACCCAGAAGCCCCACCTC
TTCTGAACCCCAGCAGCACTGATGTGGTCAAAATCTCTGC
GCTGTAGGAGCAAACAGAACTCAGGAAGAGAAACCGAAGA
GTAGCCTGCCCCCTAGTGGGAGAGGAGGTGCACTGACTCA
GACTCTCGAAATAGAAGAAGAATATCAAAGGATGCGACTG
TGTAAATGAGAGAGACGACCATGAGTATTCAATCACTCTC
CATCAGGACTGATAAAGATGAGGGTGTCATTGCAGTGTCA
CTGTGCATAGAACATTCCTCCTCCTTTTCCCTTACTAGTT
TTCTGGTGGGTCATACTGTTTATAAATCGTGGAAAAGATT
AATGTTTTAACTACAGATGAAGGCAAGAGGTCAAGCTTTT
GTTTTCATCAGAGAGTCTTGTTTTGTTTTTTTATCCGTCC
GTTAATCTGTTCCAACATCACAGACAGCCTCTCAAAGCCT
CGGCTTACTTTATCCCAATTATGTTATGTTTTGATCTAAA
GTAATTCTCAAAGGATAAGAGGGGAAAATCTGCTTTAGAG
TCTGGGGGAGACTGTACGAGTGTTTCTTAGATCGTGCTAA
GTTTTTATTTTTGGAATATGAGGTCAAGAGTTGCGTCTAA
CTTGAATGTTTCTGCCCCAAGTGAGTGTGTGTGCGTGCGA
GTTACTGAATTTGCCCCTCAAACTCTCAGCCTCTCACACA
GTTCGTGCCTCTCAGGGGGAGGAGAGTTTCCTTCTTCTTT
AAGCCACTGTCTCTCCCTGAGTCCAAAACGTTGAGCCGAC
TTTGTAACGTTAGTTGTGACCTATCAAACATTACTATGTA
ATATAGAACCAAAAAAATTGAAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations