header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-8037
Transcript Name: impdh2-201
Previous Name: impdh2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000025286 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000025286|OTTDARG00000020267|ZDB-GENE-030114-5 impdh2|OTTDARP00000020807 impdh2-001 LG_ CR382331.5 Danio rerio protein_coding KNOWN, 2335 bp
AAACCAGATAAACACCTGACTCTAAACAGAAACTTGACCG
TTTTTGCGGTGTTTACTGTCATTAAGCGCAGTGAAGACTG
AAGCTCGGAGAACAGCGCTTACCGGGCTGTGCGCACACAC
TGTCCTGAAAACACTGATTCAGTGACAATTTGGACTTTAT
ATTCACTATGGCGGACTATTTAATCAGCGGTCAAACAGGT
TACGTGCCCGACGACGGACTAACAGGACAGCAGCTTTTCA
ACTCTGGAGACGGCCTTACCTACAATGATTTCCTGATTCT
ACCTGGGTACATTGACTTCACAGCTGACCAGGTGGACCTG
ACATCAGCCCTGACCAAACAAATCACAATGAAAACCCCAC
TGATCTCGTCGCCTATGGATACAGTCACAGAGTCTGGCAT
GGCCATTGCTATGGCGCTTACCGGTGGGATTGGCTTCATT
CATCATAACTGCACTCCAGAGTTCCAGGCTAATGAAGTCC
GCAAAGTTAAAAGATACGAGCAGGGTTTCATCACAGATCC
AGTGGTGATGAGTCCTAATGAGCGGGTAAGAGACGTCTTT
CAGGCTAAGGCTCGACATGGATTCTGTGGGATCCCGATTA
CAGACAATGGACAGATGGGTGGACGGCTGGTCGGCATCAT
TTCATCTCGCGATATCGATTTCCTCAAAGAGTCAGAGCAC
GACCTGCCCCTCAGTGAGGTCATGACTAAGAGGGAGGATC
TGGTTGTAGCTCCAGCTGGAGTGACACTGAAAGAGGCCAA
TGAAATCCTCCAGAGGAGCAAGAAAGGTAAGCTTCCTATA
GTAAACGAGGAGGGTTGTCTGGTGGCCATCATCGCTCGGA
CAGACCTGAAGAAGAACAGGGATTTTCCTCTGGCCTCTAA
AGATTCTCGTAAACAGCTGCTTTGTGGTGCTGCCATTGGA
ACACACAACGATGACAAATACAGACTTGACCTGTTGGCAC
AGGCTGGTGTAGATGTGGTCGTCCTGGACTCTTCCCAAGG
CAATTCCATCTTTCAGATTAATATGATCAAGTACATAAAA
GAGAAATATCCCAATGTACAGGTCATCGGAGGCAATGTGG
TGACTGCGGCTCAGGCAAAGAATCTTATTGATGCCGGTGC
AGACGCTCTGAGAGTAGGAATGGGCAGCGGCTCCATCTGC
ATCACACAAGAAGTGCTGGCGTGCGGGAGGCCACAGGCAA
CGGCAGTGTATAAGGTATCAGAATATGCTCGGCGGTTTGG
TGTACCTGTCATCGCAGATGGGGGAATTCAGACAGTCGGA
CATATTGCTAAAGCACTGGCCCTCGGAGCATCTACAGTAA
TGATGGGGTCATTGCTTGCTGCCACTTCTGAAGCTCCTGG
TGAATATTTCTTTTCGGATGGCATCCGTCTGAAGAAATAC
AGAGGGATGGGCTCACTGGATGCCATGGATAAAAACCTGG
GCTCACAGACAAGATACTTCAGTGAGAGCGATAAGATTAA
AGTCGCACAGGGGGTTTCAGGAGCAGTTCAGGATAAAGGC
TCCATCCATAAGTTTGTTCCATATCTTTTGGTTGGCATTC
AGCATTCCTGCCAAGACATCGGTGCAAAGAGCCTTACGCA
GCTGAGAGCAATGATGTATTCTGGTGAACTGAGGTTTGAA
AAGAGGACAATGTCGGCTCAGATGGAGGGTGGAGTGCACA
GCCTACACAGCTATGAGAAGCGCCTGTTTTAAAAAAAGAC
ACTACAGATGCCAGTCATGCACAGCCAAATGCACATAAAG
CCCCAGTAATGGACTCTGCTACACGTGCTTCTGCACATAC
AGCCACCCGAACACACAGAGAACCTCAGCTTCCTCTTTCT
CGTCTTCCCAGCCGCCTTTCCTCTTAGCACAGAGAGAAAC
CATGTGTGAATGTCTGTCAGCATATGCCAATATATGTGAA
CGTGCATCTTTATTGGGAGATCATGCCGTCTGCTGTTTGT
ATCAGAAGCCCTACCTGTCAAAAAATGGCGTTTTGTTGGG
AAAAATGTATATATTTCTTAACCACTGATACTTGTGTTGT
CTTGTTTAATAAACTCCACAATACATGCATCATTAATAAG
CCATAAACAGACCATTTTCACTCCGGAGAAGAGAAAATAC
AGGATGGCTGAGTGTGTGAAACAGGAAGTATTGTATTTTA
ATGGGATTTGTGTCAAGTTTGTTATAAAAAAAGAGAAGTG
ACTATTAAAGTCAGGTGTGCGTGTATGTGTGTGCATTTGC
AGTACCTTCACAAAAAATGTGCCAGTGTCATGTAATTCAC
AACATGTTTTTTTGAGAGTGTGTTTTTCATAATAAATAGA
TTTTCAAATCCTGAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
impdh2-201 Contained in:
OTHER impdh2-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000025286 (1)
  • Ensembl_Trans:ENSDART00000009178 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC046905 (1) 2226bp
    GenBank:AI667391 (1) 734bp
    CITATIONS (2)