ZFIN ID: ZDB-TSCRIPT-090929-7979
Transcript Name: cebpg-202
Previous Name: cebpg-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000025217 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000025217|OTTDARG00000020230|ZDB-GENE-020111-5 cebpg|OTTDARP00000020754 cebpg-002 LG_ BX323060.5 Danio rerio protein_coding KNOWN, 763 bp
GCGCTCGTAGGAGAGAGAAGGAAATTTTGCCACATATGCA
CATTGACATGGCAGCACGGTCGGATTACAACAACATAATG
CTAACGGATGAGCACAAGCACTTCACCAGAGTTTTAGGTG
TTGCAGCATTTTGCTGAAATAATGCGTTTTCGCGCCGAGC
ATCTGTTCAGGCACACCGCTGCATCCTGTGTTTTTTTCAC
AATAACAGCTAACAATAACTCCAGTTTCGCGAAGGCTGAC
AACGAAGGTCAGAGAGGGCGAGCGACGGACATTGGAAGTG
GATCCAAATGAGCAAGCAGTTGCAACAGAAAATATCCAGC
ACAGATCAGAACGGCGTCAGTGTAATACAGAATCAGCCTC
ATAATAGTGCACTGAACCCAGCAGGAGCTGCAGGTCTACA
GCAGGTTCCTCAATTAGTGCCAGTGAATCCCGGCGGTGGG
GGTAAGGCCACAGCACCCAGCAAGATGAAGAAGTCTAATA
TGGATAAAGACAGCGACGAGTACCGTCAGCGGCGAGAACG
CAACAACCTAGCTGTAAAGAAGAGTCGTATGCGCAGCAAA
CAGAAGGCACAGGACACCCAGCAGCGTGTCAATGAGCTGA
AAGAGGAGAATGAGAGACTGGAGGCCAAAATCAAATTGCT
TAGCAAAGAACTGAGTGTGCTCAAAGACCTGTTTCTAGAG
CATGCTCACAACCTTGCAGACAACGTGCAACCACCTGCTT
CTGGTGGAGGCCCTGGAGACCTTTGCAACAACAACAGCGG
CAG

cebpg TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA cebpg-201 (1)    Ensembl 2451
cebpg-202 763
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cebpg-202 Contained in:
[BAC] DKEY-27K4 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000025217 (1),  Ensembl_Trans:ENSDART00000131387 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CK696408 (1) 754 nt
GenBank:DT074179 (1) 739 nt
CITATIONS (2)