Transcript

cebpg-202

ID
ZDB-TSCRIPT-090929-7979
Name
cebpg-202
Previous Names
  • cebpg-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000025217 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000025217|OTTDARG00000020230|ZDB-GENE-020111-5 cebpg|OTTDARP00000020754 cebpg-002 LG_ BX323060.5 Danio rerio protein_coding KNOWN, 763 bp
GCGCTCGTAGGAGAGAGAAGGAAATTTTGCCACATATGCA
CATTGACATGGCAGCACGGTCGGATTACAACAACATAATG
CTAACGGATGAGCACAAGCACTTCACCAGAGTTTTAGGTG
TTGCAGCATTTTGCTGAAATAATGCGTTTTCGCGCCGAGC
ATCTGTTCAGGCACACCGCTGCATCCTGTGTTTTTTTCAC
AATAACAGCTAACAATAACTCCAGTTTCGCGAAGGCTGAC
AACGAAGGTCAGAGAGGGCGAGCGACGGACATTGGAAGTG
GATCCAAATGAGCAAGCAGTTGCAACAGAAAATATCCAGC
ACAGATCAGAACGGCGTCAGTGTAATACAGAATCAGCCTC
ATAATAGTGCACTGAACCCAGCAGGAGCTGCAGGTCTACA
GCAGGTTCCTCAATTAGTGCCAGTGAATCCCGGCGGTGGG
GGTAAGGCCACAGCACCCAGCAAGATGAAGAAGTCTAATA
TGGATAAAGACAGCGACGAGTACCGTCAGCGGCGAGAACG
CAACAACCTAGCTGTAAAGAAGAGTCGTATGCGCAGCAAA
CAGAAGGCACAGGACACCCAGCAGCGTGTCAATGAGCTGA
AAGAGGAGAATGAGAGACTGGAGGCCAAAATCAAATTGCT
TAGCAAAGAACTGAGTGTGCTCAAAGACCTGTTTCTAGAG
CATGCTCACAACCTTGCAGACAACGTGCAACCACCTGCTT
CTGGTGGAGGCCCTGGAGACCTTTGCAACAACAACAGCGG
CAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations