Transcript

cebpg-201

ID
ZDB-TSCRIPT-090929-7978
Name
cebpg-201
Previous Names
  • cebpg-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000025216 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000025216|OTTDARG00000020230|ZDB-GENE-020111-5 cebpg|OTTDARP00000020753 cebpg-001 LG_ BX323060.5 Danio rerio protein_coding KNOWN, 2291 bp
ATACTCCCAAGCGCCGCTTTACCAAACAATAACACCTCAA
CCTGTGCTTATTTTTCCGTGAACAAAGAGGACATTATTCT
TTATTTACCCGAGCGGAGGACTTATAAGGCACGAACGTTC
GAGGCACACCGCTGCATCCTGTGTTTTTTTCACAATAACA
GCTAACAATAACTCCAGTTTCGCGAAGGCTGACAACGAAG
GTCAGAGAGGGCGAGCGACGGACATTGGAAGTGGATCCAA
ATGAGCAAGCAGTTGCAACAGAAAATATCCAGCACAGATC
AGAACGGCGTCAGTGTAATACAGAATCAGCCTCATAATAG
TGCACTGAACCCAGCAGGAGCTGCAGGTCTACAGCAGGTT
CCTCAATTAGTGCCAGTGAATCCCGGCGGTGGGGGTAAGG
CCACAGCACCCAGCAAGATGAAGAAGTCTAATATGGATAA
AGACAGCGACGAGTACCGTCAGCGGCGAGAACGCAACAAC
CTAGCTGTAAAGAAGAGTCGTATGCGCAGCAAACAGAAGG
CACAGGACACCCAGCAGCGTGTCAATGAGCTGAAAGAGGA
GAATGAGAGACTGGAGGCCAAAATCAAATTGCTTAGCAAA
GAACTGAGTGTGCTCAAAGACCTGTTTCTAGAGCATGCTC
ACAACCTTGCAGACAACGTGCAACCACCTGCTTCTGGTGG
AGGCCCTGGAGACCTTTGCAACAACAACAGCGGCAGTAAC
AGCAGCCAGTGAGGGTTCGTTTGCAATGTGAAGGCTCTCG
AGGCGAATCAGTTTTCTTAATCGTATTATGCTTTTCCCCT
CCTGTTCCTGGAATGTGTACTGTGTCCGCAGTGTTTTCTG
TGTTTTCTGTTGGTACATTCAAATTCAGTTTCTTTTTCAC
TCGTATCTCGTGGAATGTTATGATATATTCGCCATAGCAA
CCACAGAAAGTCCGACCCATGCTCTTATTTGATGTGCTGG
AGATAACGAAAATATCCAGCAACCATAAAGCGACATGTTC
ATGAAAGCTTGTGCTGACTTGGAGGGCTGTGAAAGCTTCT
CAATAGACAATCCGGAGCAAAGCAGTTGAAATACTAATAG
GAAATGCATTCCATCACTCCACTCTATTGTCTAAACTGAT
GAACAGATGCTGCAATCTTTAAATAATATACATTTTTGCT
AGGAATTAGGGCTACCAAACATTTAAGTAAGGATGTCACC
AGAAGAGTACTTATTTTGTCTTCTTGCTTTCTGCCTGTCA
GCTTAAGTTGATTTGAAACTCTTATTTGTTGACCATGTCT
TATTTTAGCACATACACTGTTGTATCTATGGTAACAGACT
CTAGACAGACAAAACGTATTGCATCAGACTCCAGACAGTG
TCTGCATTACCAGTAGTCTTCAAATCCCTACAGTTAAGCC
ACCAATTCTGACAAGGGTGGAGAAGGAGAGATAGAGAATA
TTTGCTCTAGCCTGTTTGTTAGGGTGTTGGTAGCCTAATT
AACTCAAACATATTTCATAACAGTCTGTGTAAATACCGTT
GATGGTGCAGACAAGATTTATTAGGACTAGTACCTAGACT
GGTGCTGAACTTCTTCAATCACCTGATGTGCCCTAAATTG
ATGAAATGATCTAGATACAGTTCTATTCAGAAGTTCCTTA
TCCAAATAAGCTCTTTATCTGGCTACAAATTTTGTCCATT
TGGTTTCCCTGACCAGTCTCTGAGAAGTATGTGTGAATTT
ACATCTGCAGCTGCAGGTGTTACTTGGAGTTATTTGGAGC
AGCCACATGACCCTTGCCCTTATTGATTCTCATAGAGTTG
TGTGTTCTTGGAGCCGCTGTAGATAGACTTTTGTACCTCA
GGCTATATGTCATAGCCTCACCAGACAGCCTTTAATATCT
ATATTCCTGTTTAAAATAAAATGAAAACGCCTAGCATAAG
AAAAGTCAAGGCAATCGTGTAAGATGTCTGAAGCATCTAC
TGTATATTTCCATTTTCTATACCTGAAGTTTTAAAACCTG
AAAAAAGCATGAAAGGCAATGCATGATTAGCACTATTTAA
ACAACTAATTAAGAGTTTTGCTCTATAGAGGAATAGTGAA
TTGGCGACTGCATACTTTTGTAATATATCAGGCTGCGCGA
AAAAATAAAACTGTTGTGTAAAAGTTCTTAAAAATGAAAC
TAGTCAATAATTCATGAATATTTGATTGGCATATTTTGCT
TAAGTATGAGGGTTGCTGGGCAACTTGCTTTTTTACATAA
TGTATACTTGGGTTTCTGTGCATTGTAAATTAAAGTTGAA
TACAAAAAACA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations