ZFIN ID: ZDB-TSCRIPT-090929-7978
Transcript Name: cebpg-201
Previous Name: cebpg-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000025216 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000025216|OTTDARG00000020230|ZDB-GENE-020111-5 cebpg|OTTDARP00000020753 cebpg-001 LG_ BX323060.5 Danio rerio protein_coding KNOWN, 2291 bp
ATACTCCCAAGCGCCGCTTTACCAAACAATAACACCTCAA
CCTGTGCTTATTTTTCCGTGAACAAAGAGGACATTATTCT
TTATTTACCCGAGCGGAGGACTTATAAGGCACGAACGTTC
GAGGCACACCGCTGCATCCTGTGTTTTTTTCACAATAACA
GCTAACAATAACTCCAGTTTCGCGAAGGCTGACAACGAAG
GTCAGAGAGGGCGAGCGACGGACATTGGAAGTGGATCCAA
ATGAGCAAGCAGTTGCAACAGAAAATATCCAGCACAGATC
AGAACGGCGTCAGTGTAATACAGAATCAGCCTCATAATAG
TGCACTGAACCCAGCAGGAGCTGCAGGTCTACAGCAGGTT
CCTCAATTAGTGCCAGTGAATCCCGGCGGTGGGGGTAAGG
CCACAGCACCCAGCAAGATGAAGAAGTCTAATATGGATAA
AGACAGCGACGAGTACCGTCAGCGGCGAGAACGCAACAAC
CTAGCTGTAAAGAAGAGTCGTATGCGCAGCAAACAGAAGG
CACAGGACACCCAGCAGCGTGTCAATGAGCTGAAAGAGGA
GAATGAGAGACTGGAGGCCAAAATCAAATTGCTTAGCAAA
GAACTGAGTGTGCTCAAAGACCTGTTTCTAGAGCATGCTC
ACAACCTTGCAGACAACGTGCAACCACCTGCTTCTGGTGG
AGGCCCTGGAGACCTTTGCAACAACAACAGCGGCAGTAAC
AGCAGCCAGTGAGGGTTCGTTTGCAATGTGAAGGCTCTCG
AGGCGAATCAGTTTTCTTAATCGTATTATGCTTTTCCCCT
CCTGTTCCTGGAATGTGTACTGTGTCCGCAGTGTTTTCTG
TGTTTTCTGTTGGTACATTCAAATTCAGTTTCTTTTTCAC
TCGTATCTCGTGGAATGTTATGATATATTCGCCATAGCAA
CCACAGAAAGTCCGACCCATGCTCTTATTTGATGTGCTGG
AGATAACGAAAATATCCAGCAACCATAAAGCGACATGTTC
ATGAAAGCTTGTGCTGACTTGGAGGGCTGTGAAAGCTTCT
CAATAGACAATCCGGAGCAAAGCAGTTGAAATACTAATAG
GAAATGCATTCCATCACTCCACTCTATTGTCTAAACTGAT
GAACAGATGCTGCAATCTTTAAATAATATACATTTTTGCT
AGGAATTAGGGCTACCAAACATTTAAGTAAGGATGTCACC
AGAAGAGTACTTATTTTGTCTTCTTGCTTTCTGCCTGTCA
GCTTAAGTTGATTTGAAACTCTTATTTGTTGACCATGTCT
TATTTTAGCACATACACTGTTGTATCTATGGTAACAGACT
CTAGACAGACAAAACGTATTGCATCAGACTCCAGACAGTG
TCTGCATTACCAGTAGTCTTCAAATCCCTACAGTTAAGCC
ACCAATTCTGACAAGGGTGGAGAAGGAGAGATAGAGAATA
TTTGCTCTAGCCTGTTTGTTAGGGTGTTGGTAGCCTAATT
AACTCAAACATATTTCATAACAGTCTGTGTAAATACCGTT
GATGGTGCAGACAAGATTTATTAGGACTAGTACCTAGACT
GGTGCTGAACTTCTTCAATCACCTGATGTGCCCTAAATTG
ATGAAATGATCTAGATACAGTTCTATTCAGAAGTTCCTTA
TCCAAATAAGCTCTTTATCTGGCTACAAATTTTGTCCATT
TGGTTTCCCTGACCAGTCTCTGAGAAGTATGTGTGAATTT
ACATCTGCAGCTGCAGGTGTTACTTGGAGTTATTTGGAGC
AGCCACATGACCCTTGCCCTTATTGATTCTCATAGAGTTG
TGTGTTCTTGGAGCCGCTGTAGATAGACTTTTGTACCTCA
GGCTATATGTCATAGCCTCACCAGACAGCCTTTAATATCT
ATATTCCTGTTTAAAATAAAATGAAAACGCCTAGCATAAG
AAAAGTCAAGGCAATCGTGTAAGATGTCTGAAGCATCTAC
TGTATATTTCCATTTTCTATACCTGAAGTTTTAAAACCTG
AAAAAAGCATGAAAGGCAATGCATGATTAGCACTATTTAA
ACAACTAATTAAGAGTTTTGCTCTATAGAGGAATAGTGAA
TTGGCGACTGCATACTTTTGTAATATATCAGGCTGCGCGA
AAAAATAAAACTGTTGTGTAAAAGTTCTTAAAAATGAAAC
TAGTCAATAATTCATGAATATTTGATTGGCATATTTTGCT
TAAGTATGAGGGTTGCTGGGCAACTTGCTTTTTTACATAA
TGTATACTTGGGTTTCTGTGCATTGTAAATTAAAGTTGAA
TACAAAAAACA

cebpg TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA cebpg-201 2451
cebpg-202 (1)    Ensembl 763
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cebpg-201 Contained in:
[BAC] DKEY-27K4 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000025216 (1),  Ensembl_Trans:ENSDART00000052365 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC049400 (1) 2296 nt
GenBank:AF306856 (1) 2288 nt
GenBank:BC071296 (1) 1923 nt
GenBank:EH497565 (1) 1021 nt
CITATIONS (2)