header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-7932
Transcript Name: dio2-201
Previous Name: dio2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000025169 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000025169|OTTDARG00000020207|ZDB-GENE-030327-4 dio2|OTTDARP00000020718 dio2-001 LG_ CR381576.10 Danio rerio protein_coding KNOWN, 2166 bp
CTCTGGTTAATTGTAATGCGGAAAGGAGGGGGGCACTTGG
CACCGGCGCTCCTCTGTGCGTAAAGACGCCTGATGCTTGG
CGAGACGCAGATTCGGGCTCACCGCGCGCTAACGCCCACA
TCCTCAAGCCGACTCTGCTTTCTTTAGGTGAATGAAAGTT
TGCTAGGAGGGGGACGGCAGAAGAAATGATATCTGACCAG
GATGAGTCGGAAAGGTGAAGTTAAATAAGCAAAAGTGCGC
GTCAACCACCTGTTATAAATCAGCGCGAAATGGGCTTGCT
TAGTGTGGACCTCCTGGTAACTTTGCAGATTTTGCCTGGC
TTCTTCTCCAACTGCCTGTTTTTCGTGCTGTATGACTCGA
TAGTGCTGGTTAAGCGTGTGGTGTCACTCCTGAGCTGCTC
GGGCTCCACGGGTGAGTGGCAGCGCATGTTAACCACAGCC
GGCGTGCGCTCCATATGGAACAGCTTTCTTCTGGATGCCT
ACAAACAGGTGAAATTGGGCGAAGCTGCTCCAAACTCTAA
GGTGGTGAAAGTCACTGGCATCAATAGATGCTGGAGCATC
AGCGGTAAGACCCACAACCAGTGCCACCTGCTGGACTTTG
AGTCTCCTGATCGCCCGTTAGTGGTCAACTTCGGTTCGGC
CACTTGACCCCCCTTTATAAGCCAGCTGCCGGTCTTCCGG
CGGATGGTGGAGGAATTTTCAGATGTGGCAGATTTCCTGC
TGGTCTACATCGATGAGGCTCACCCTTCAGACGGCTGGGT
GGGTCCTCCCATGGAGAACTTTTCGTTTGAAGTGAGGAAA
CACCGAAATCTGGAGGAGAGGATGTTTGCCGCCAGGACAC
TTCTGGAGCATTTCTCCTTGCCTCCTCAGTGCCAGTTGGT
GGCCGATTGCATGGACAATAATGCCAACATAGCCTACGGT
GTGTCCTACGAGAGGGTCTGCATCGTGCAGAAGAATAAAA
TCGCTTACCTTGGGGGTAAGGGTCCATTTTTTTACAACCT
TAAAGATGTTCGGAGGTGGCTGGAGAAGTGCTACGGAAAG
TGATAATTTCTCGGAGAAAATAAAGAGGTCAAAATAGCCT
TTTCTGTGAATGTTAGAAGATTTTATTTTTGTATAATGGA
GAGAATCGAGGGAAGGTGCTTTTGGGACTGTTTAACGGTG
GCTCCAGTGGAAACACTTGGGCTGGGCTCCAAGTCATTTT
TTTTTGAATATTTTTTTAAAATGATAAACAGGTGTCCTAC
ATTCCTAACCACTTTAAAAAGAAAGAATGAAATGAATATA
GACACTAAATACTGACCTTGTGGTTTGCACTTCAATTTTG
AGATTACATTGTTGCCAGCAAAATGATTTGTAGATGCACT
ATTAATAACTTGTTCCTTTTGCAATTAATGTAGAGTTAAA
AGTGTGCAATATTTTTATGCGACATAACATATATTGCTTA
CAAAAGAAAACCAAATTGCTGAAGAGAAGAGAAAGCACAA
GTTCCCAGCTTTTATATGAAAAGAGAATAATTTATTTTTA
TTGACATGTTTATTTTTTAATATGTGGCCTGTTTATGCAC
TTGTAATGCTTTCCCTCGCCCTGACAACTGACAATCATTC
ACATTCCATGTATCAGCTTTTACATTCGCACCAGTAACAA
AAGCATTATCGGCATCCAATAACCACAGCTACTAATAATG
CAAGTCGTTTGACCTGTATTGTACTCTTACCGCTCTTAAT
AAGCTGGACAAATGGAGGGAAAATTCTCCCAGCAGCCGCA
GCCACCGAACTTAACTCGGACACTTGGCTTGACTGCTGTG
TACAGGAAAGCTGACGGAAAGTTCTTTTACTCCTGAATGT
TAGAGAAATGTTTTTGAATGTTGTTGATGGTGACTTTAAC
GCATAGGCAGTCGCTCATTTGGTTCAATACGGTGTTGGTG
TGCACATGAAAATCACAGATGAAATGGTCCCCTGTCCTGT
CTGTGGTTGGATGAGAGACCACACCTCTCCGTCCTGATCC
AAATAGGCATGACTGCTAACATGCGGAAACAATCACTCTG
AATCTGAATCACTCTGAAGGCTTTGAGTTTTGCTTCACAG
AACAGTTCTCATGTACTACAACTGTCCTCGTCCTTTTAAT
GAGAAAAAGGCAAGACAAAATAAAGTTGAACTGCTGCTGA
CTATGA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
dio2-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000025169 (1),  Ensembl_Trans:ENSDART00000146276 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC059608 (1) 2175 bp
GenBank:CN331859 (1) 906 bp
GenBank:CN320863 (1) 889 bp
GenBank:AY221260 (1) 777 bp
GenBank:CD596023 (1) 650 bp
CITATIONS (2)