header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-7907
Transcript Name: tle3b-002
Previous Name: gro1-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000025143 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000025143|OTTDARG00000020193|ZDB-GENE-990415-85 tle3b|no_translation gro3-002 LG_ AL954672.9 Danio rerio protein_coding KNOWN, 529 bp
TGTGCTGGAGCGCCGTTTGGCTTCGTGAACAGCACACACA
CCATATCAACGCTCGAAGAGCCTCATGTTTATGCTGCACC
AACTCATGGCAACATCAGCATAGGCAGACGTTTCTGAAGT
TTTTACTTCATTAATCAGGAGTACTGGAGGTATCCCATCA
TGCCTCATTTAGATCTGCGGAGGCTTGATTAGAGTATTCA
CCAACGTGAAAGTAACGTGAGGGCATCAGAGCGCACGCTG
CCGAGATTTAAGTACATTTGAGTGATTGGAAAAGAGCTGA
CAATTTAATAACCGCAGCGTTTGTGTGTCTGTTTTTCTTT
TTCAGACTGAGATTGCCAAACGGCTAAATGCAATTCTTGC
TCAAATCATGCCTTTTTTGTCACAAGAGCACCAACAGCAG
GTCGCACAGGCTGTTGAACGTGCTAAGCAAGTGACAATGA
CCGAGTTGAATGCCATCATCGGGGTACGTGGACTTCCCAA
TCTGCCTCTCACCGTGTGTATACCCCTCTTTCTTATTTAT
TTGACCTGG

tle3b TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA tle3b-002 529
tle3b-004 (1) 593
mRNA tle3b-201 (1) 4239
tle3b-203 (1) 598
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
tle3b-002 Contained in:
OTHER tle3b-002 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000025143 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CT691674 (1) 552bp
    CITATIONS (1)