header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-7906
Transcript Name: tle3b-201
Previous Names: gro1-001, tle3b-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000025142 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000025142|OTTDARG00000020193|ZDB-GENE-990415-85 tle3b|OTTDARP00000020698 gro3-001 LG_ AL954672.9 Danio rerio protein_coding KNOWN, 2840 bp
TACGAGGCAAACTTTTCACCATCAAACCATTTTTAAACAA
GCAATCAAATAGGGATTGGGAGAATTTATCAACACCCTGA
GAACTGTGTTCAAGCAAGTCTTAACAGAGGAAAACAATCT
CGAAGCGATTGTTAGGCGCTGCTTTTTTCTTCTAGGGTTG
GGATTGATTCCCAACCAGCGCCTAATACTGATCGTATAAG
GTCACGAGTGGAGGACTTCGACGTTTCCTCGGTGCAAGGA
ATTATTGCTGCATTTACCTTCGCGGAAAGGGATTTTATGG
AGACTGAAGGATAAAGGGGTTAAACCGGGGATCAGGAGCG
GGAGAAGCGCGTGCATCGGGTGGACGGACCGGGCTTTGTG
TGTCCGCGAGTGCTGGGAGGGGTGACGGACGGGCTCTCTC
TCATCTACTCGGATTACTGAAGAGCGCCACATCCCCTGGA
TCTTCTCTTCGGAAAGGATACATTCAAGATGTATCCGCAG
GGCCGGCATCCGGCACCTCACCAGCCTGGCCAGCCGGGCT
TCAAATTCACTGTAGCAGAATCTTGTGACAGAATCAAAGA
CGAGTTTCAGTTCCTTCAAGCTCAGTACCACAGTCTTAAA
GTGGAGTACGACAAACTGGCCAATGAGAAGACTGAGATGC
AGAGGCATTATGTTATGTACTATGAGATGTCATATGGACT
GAACATTGAAATGCATAAACAGACTGAGATTGCCAAACGG
CTAAATGCAATTCTTGCTCAAATCATGCCTTTTTTGTCAC
AAGAGCACCAACAGCAGGTCGCACAGGCTGTTGAACGTGC
TAAGCAAGTGACAATGACCGAGTTGAATGCCATCATCGGG
GTACGTGGACTTCCCAATCTGCCTCTCACCCAGCAGCAGC
TCCAGGCTCAGCATCTTTCTCATGCTGCCCATGGACCACC
AGTCCAGCTGCCCCCTCACCCCTCGGGGCTGCAGCCCCCA
GGCATCCCTCCAGTCACAGGCTCAGGGTCAGGTCTGCTGG
CACTGGGAGCTCTGGGCAGCCAGGCACACCTGCCAGTCAA
AGATGAGAAGAACCACCATGACCTGGAGCACAGAGAGCGG
GAGTCTAGCACGAATAATTCCGTATCACCGTCAGACAGCC
TGAGGGCCAGTGAGAAACATAGAGGCTCTTCTGAATACAG
TCTGGATCCAAAGAAGCGTAGAGTGGAGGAGAAGGACAAC
ATGAGCCGATATGATAGCGATGGTGACAAAAGTGACGATC
TGGTGGTGGATGTGTCCAACGAGGATCCAGCTACTCCAAG
AGTCAGCCCGTCACACTCTCCTCCTGAGAACGGTCTGGAT
AAAGCCAGAGCGCTGAAGAAAGACGCCCCAAACAGCCCAG
CTTCCGTGGCGTCCTCTGGGAGCACCCCATCCTCCAAAGC
GAAGGACCACCCACATAACGACAAGTCCTCCACCCCAGGT
TTGAAGTCCAACACCCCTACCCCACGCAACGACGCTCCCA
CCCCAGGAACCAGCAACACCCCCGGGCTCAGGCCCCATCC
CGGAAAACCACCTGGCATGGAAGCACTGACAGCACCTGCT
CTTCGTACACCATTGTCGATTGCACCACCATATGGGACTC
CCTTCATGATGGGTCACCACCCAGAGATGAACGGCTCATT
GACCAGTCCTGGTGTTTATCCTGGCCTTCACATTTCTCCT
CAGATGAGCGCAGCAGCCGCTGCTGCCTATGGACGCACAC
ATATGCCGGGCTTTGATCCTCATCCCCACATGCGTGCACC
CGTTCTGCCAGCAAGTCTGACCTCTATCCCTGGAGGAAAA
CCGGCCTACTCCTTCCATGTTAGCGCGGATGGCCAGATGC
AGCCAGTTCCGTTTCCTCCTGACGCTCTGATTGGTCCAGG
AATTCCCCGTCACGCTCGCCAGATCAACACACTGAGCCAC
GGAGAGGTTGTGTGCGCTGTGACCATCAGCAACCCCACAC
GGCATGTTTACACTGGTGGCAAGGGCTGTGTGAAGATCTG
GGATATCAGTCAACCCGGCAGCAAGAGTCCCGTCTCACAA
CTCGACTGCCTGAACAGGGATAACTATATCCGTTCCTGTA
AGCTGCTTCCGGATGGCCGTACTCTGATTGTTGGAGGGGA
AGCCAGCACTCTGACCATATGGGATTTGGCCTCTCAGACT
CCTCGTATCAAAGCAGAGCTCACCTCTTCTGCCCCGGCTT
GTTATGCGCTGGCGATCAGCCCTGATGCCAAGGTCTGCTT
CTCCTGCTGCAGTGATGGAAATATTGCCGTCTGGGACCTT
CATAACCAAACCCTTGTGAGGCAGTTCCAGGGTCACACAG
ATGGGGCGAGTTGTATAGATATTTCCCATGATGGCACCAA
ACTGTGGACAGGTGGACTGGACAACACTGTACGGTCCTGG
GACCTGAGAGAGGGTCGCCAGCTTCAGCAGCATGACTTCA
CATCACAGATCTTCTCTCTGGGCTACTGTCCGACGGGCGA
GTGGCTGGCTGTGGGAATGGAGAGCAGTAATGTGGAGGTG
CTTCATCACACCAAGCCTGACAAGTACCAGCTGCACCTGC
ACGAGAGCTGTGTCCTCTCCCTCAAATTTGCTTACTGTGG
TAAATGGTTTGTGAGCACTGGGAAGGACAATCTCTTGAAT
GCCTGGAGGACTCCCTATGGTGCCAGCATTTTCCAGTCCA
AGGAGTCGTCCTCTGTCCTGAGCTGTGACATCTCGGCTGA
TGATAAGTACATTGTGACGGGATCTGGTGACAAGAAGGCC
ACGGTGTATGAAGTCATCTACTAAACTCGCTGCTTCACCA
GAACTAAAGACCTATGGATGGGCCTGATTTGTTTTGATGG

tle3b TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA tle3b-002 (1) 529
tle3b-004 (1) 593
mRNA tle3b-201 4239
tle3b-203 (1) 598
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
tle3b-201 Contained in:
OTHER tle3b-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000025142 (1)
  • Ensembl_Trans:ENSDART00000130553 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AB040707 (1) 2422bp
    GenBank:EH583600 (1) 1046bp
    GenBank:EH601023 (1) 802bp
    CITATIONS (2)