header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-7898
Transcript Name: slc17a6b-202
Previous Names: slc17a6-001, slc17a6b-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000025134 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000025134|OTTDARG00000028578|ZDB-GENE-030616-554 slc17a6b|OTTDARP00000031181 slc17a6-001 LG_none AL929252.6,BX537356.4 Danio rerio protein_coding KNOWN, 2251 bp
GGAGCTCGCGCTGATCTGAACGCGAGTCTGTCGCTGACCT
TGGTGCTGAAAGCCATTTACCGCCCTTTAAAGCCACTTAA
CTGGCACTTCAATCGGAAAAAGTGACAGTACGGTACAAGG
AAATTGGACCTATTTTTCTTTTAATCTGTGTTTTTGATCA
CAAGTGATTTTAATCAGAACTCCGTGTTCATTGAGTTAAA
TCTGAGATGGCATCGCGTGCCCCTATCGCGCGCGGGGCAG
TTTATGAGTTTATAATAATGAGTAGACAGAGCCAGACCAC
TTCTGATCTCTCACTCGTGTAAGCGGATTTTTTTTCCCTT
CGCTCTGTGAACACCGTCGTGAATTTTCCCCATCCGTCTT
ATACTGAATCATTGATCCGCTGGGTATGCTCTCTCATCTC
ACACTGTGACATGGTACTTTAACATTACCTGGGAAAAAAA
CGAGGGATTTTCACATTTGGACATGGAGACTCCGAGGGAG
CCTGCTGGTTTTAGCAAAGAGGGGCTGAAGCAACTTGCGG
GGAAGACACTGGGGCACGTGTACAGGGTGATAGAAAAGCG
GCAAAAACCTGGTGAGAACATTGAACTGACCGAGGATGGA
CGGCCTGCCCAGATCAACGAGAGAAAAGCACCTTTGTGCG
ACTGTACTTGCTTCGGACTTCCGCGCCGCTACATCATCGC
CATAATGAGCGGCCTCGGTTTCTGTATCTCCTTCGGTATT
CGGTGCAACTTAGGCGTGGCCATAGTGAGCATGGTGAACA
ACAGCACCATTCACCTGAACGGAAAGATCATCATCAAAGA
GAAAGCAAAGTTTAACTGGGATCCGGAAACAGTTGGATTG
ATTCATGGCTCGTTTTTCTGGGGTTATATAGTGACGCAAA
TTCCCGGAGGATACATTTCTTCAAGACTGGCGGCAAACAG
GGTTTTTGGCGCGGCGATTCTCCTCACGTCCACACTGAAT
ATGTTCATCCCCTCAGCTGCACGTGGTCACTATGGTTGCG
TCATATTCGTCAGGATATTACAAGGGCTTGTAGAGGGTGT
AACTTACCCAGCCTGTCATGGGATCTGGAGTAAGTGGGCC
CCTCCACTGGAAAGAAGTCGTCTGGCCACAACCTCCTTCT
GTGGTTCCTATGCTGGGGCTGTCATTGCCATGCCTCTGGC
TGGGATCCTGGTGCAGTACACGGGCTGGTCTTCTGTTTTC
TATGTCTATGGCTGCTTTGGGATTTTCTGGTACATGTTCT
GGATCTTGGTGTCATATGAGAGCCCGGCTGAACACCCCAC
CATCACAGCTGAGGAACGCTGCTACATTGAGGAGAGTATC
GGAGAGAGTGCTAAGCTGCTAGGACCTGCAGATAAATTTA
AGACACCTTGGAGGAAGTTTTTCACATCCATGCCCGTCTA
TGCAATCATCGTTGCCAACTTCTGCAGGAGTTGGACCTTC
TACTTGCTGCTCATCAGCCAGCCCGCATACTTCGAGGAGG
TGTTTGGCTTTGAGATTAGCAAGGTTGGCATGTTGTCAGC
TCTGCCCCATCTGGTGATGACCATTATTGTGCCCATTGGG
GGACAGCTAGCCGATCACCTTCGCAGCAAAAACATCCTGT
CTACAACTACGGTTCGAAAGATCATGAACTGCGGAGGTTT
TGGGATGGAGGCCACTCTGTTGTTGATTGTTGGTTATTCA
CACAGTAAAGGAGTGGCTATTTCATTTCTAGTGTTGGCTG
TCGGCTTCAGTGGATTTGCAATATCAGGTTTCAACGTTAA
TCATTTAGACATTGCTCCTCGCTATGCCAGTATCCTCATG
GGCATCTCTAATGGAGTGGGTACCCTGTCAGGAATGGTGT
GTCCTCTTATTGTCGGAGCCATGACTAAACACAAGACCCG
AGAAGAGTGGCAGTATGTGTTTCTTATCGCTTCTCTGGTG
CACTATGGTGGTGTAATCTTCTATGGCATCTTCGCCTCTG
GGGAGAAGCAGCCGTGGGCAGACCCAGAGCTGACCAGTGA
TGAGAAGTGCGGCTTCATTGATGAAGACGAGCTGGCGGAG
GAGACAGGCGACATCACCCAGAGCTACGGTGCCCTCGGAG
CTCCAGCCAAGAGTTACGGTGCCACCACACAGCTGAACGG
AGGATGGGCTGAAGGATGGGATAAACGAGAGGAGTATGTG
CAGGACGGGGTGGAGGAAGGGGGTTATGGATACAGGCAGG
GTGGAAATTATTCCTAGGTCTTGAGAAGACACAATATATG
ACAAAGACACA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
slc17a6b-202 Contained in:
OTHER slc17a6b-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000025134 (1)
  • Ensembl_Trans:ENSDART00000099872 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AB183386 (1) 1889bp
    GenBank:BC162508 (1) 1887bp
    GenBank:AL729733 (1) 699bp
    GenBank:AL729692 (1) 680bp
    GenBank:EB945409 (1) 634bp
    GenBank:EB945031 (1) 460bp
    GenBank:DN903467 (1) 432bp
    GenBank:EB841426 (1) 334bp
    GenBank:EB778957 (1) 284bp
    GenBank:BI845367 (1) 241bp
    GenBank:BI845689 (1) 222bp
    GenBank:EB941071 (1) 222bp
    CITATIONS (2)