Transcript

depdc1a-201

ID
ZDB-TSCRIPT-090929-7868
Name
depdc1a-201
Previous Names
  • depdc1a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000025099 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000025099|OTTDARG00000020165|ZDB-GENE-030131-9827 depdc1a|OTTDARP00000020664 depdc1a-001 LG_ CR759968.6 Danio rerio protein_coding KNOWN, 3393 bp
GCGTTGTAATTTCAAACGGGTGTGAGGAAAGGAACAACCT
CGGATTATCTGTTTACACAGCCCGCGATAGCTCAATAAGC
GACTTTATTTTTCGATAAGTATAGCGTGCGTATTTAATAT
AGCTAGCAAATGCATTCAGTTAATTAAAAGTAAACTCTCA
TGTATTTGTAGGAATAATGAAAACGGCTTTATAGTCGTTG
GACGCACCGTAATCTTTCAATGAGTTCTCACATCGTCACC
CCGGGTCCATACAGGGCCACTAAACTGTGGAATGAAGTGA
CCAAGCTTTTCCGAGCCGGGATGCCTTTGAAAAAGCACCG
GCAGCACTTTAGAGTTTACACGAACTGCTTCACCGCATCC
ACCGCTGTGGACTGGTTACATGAACTCTTGAAAAACAACA
GCAATTTTGGACCAGATGTCACCCGACAGCAGACAGTCCA
GCTGCTGAAAAAGTTTTTGAAGAACCATGTTATTGAGGAT
GTGAAGGGTAGATGGGGCATGGAGGACCTGGAGGACAACA
GCCAACTATACAGGTTTCCATCAACATCTCCTCTGAAGCC
TATTCCTAACCGTCCCACTGTTATGAGGAGAAAGAGCTTA
TCCATGATGGACAGGGAGAGTTTCTTCAAGTTCAGGGGCT
CGAAGAAATTTGATAAAGAAACATTGGAAAATGTGGATCC
AGAAACACAAGAGTCTCCTGTGGGATCGTCCTCAGGTGAG
ACGGAGCGCAGTAGGGAGCTCACAGAGGATGATATTCATG
TGATCTGGAAGAATGTGACACTTACACATTTGCAGAAGTT
GGTGGGATCTGCTTCTCTGGAAGGCGTTTTGGATCCAGCC
AAGGTCAATCCTCAGTTCATTGTGTATAATATGACCAAAG
TCAATAAACATGGAGTCGTTTCATTGGAGGATAAAACAGA
AGATTTACCGCACTGGGTATTGTCTGCTATGAAATGTCTA
GCAAACTGGCCAAAGTATGACTCAGACCAGCCGACTTACC
TAGGATTTGAGCGGGATGTGTTTAAAACGGTCTCAGACTA
CTTCTACAGTCTTCCTCAGCCACTGCTCACTTATCAGTAT
TACGAACTCTTTGTCAACATCCTGGTTATGTGTGGCTACA
TCACGACTCCTAAATCCCAACCTGGAAAGCGTAAAAACCA
GGAGGAGCCAAACTGCCCACAGCCTGCCAAAAACCCATAT
GTGAACCCAGCCAACCTGTTCAGGTCCACCGAATGCCTAC
TGCTCAGCTTAATAAGAAAAGAGGCCATCGATGAAGCCGA
TTCGCCCATGAAGGAAGTTTTCAGTTCAAAAACAGAGACC
AAGTTAGAAACCCGTAGAGTTTTTAGAGGTAGAAGGGTCA
GCGATGGAGACAGGCTGGATGGTAGCTATCTAGATGTTTC
TCAGGCCCACAAAACAGATGTCCCATATGGCAGGCTTCGT
CCCAGAAGTTGTTCACTGGAGGGAAACATTAATAACTGTG
CCAAAAACAGACTTTTTAGGTCGTCTGAAAGCCTCGAGTC
CTGTAGCAGTGATAAATCAAACCCTGAAACTGATTCTCCA
TTAGAACCAAACCTCCAGAGTTCCTTGGTATCCATAAACA
CTTCCGGCAGCAGCGTGAGCTCCCAACTTTCAGCAGATCT
GCGGCGAAACAACTCGAGACCTGCCAGAGCCCGGCCCAGA
AGCATTGGTAACTTGTTTGATATAGAGGAGAATAGAGAAA
TGTCTGCTAGCAGCTTTAGTGTTCATGCACCCGTGGCTGA
AATTACTATGAGACCTGACTCCACATCCAGTGTTGGCTTC
AGAGGTCTCGGTTTGTCCAGTTTGCATGGAAGTTGCGTGG
ATGTTAGAACAGGTCCAAGCTTTAGCAGACGCTGTCAGAG
CTCTCTGGACCTGAGCAAACCTGCACCCGCTCGGCCTCCT
TCAGCCCTGTTAACACACCAGCCTGAGCAAAGTTTATTAC
AGCCGTCACTGGAGCAGGTGGCCGTCGAGGCTCTTCAGCT
CTGCACGTTACTCTTGCCTCCCGTCAGCCGCCGCAAACTC
CAGCTGCTCTTGCGGATGATCTCACGCATGAGCCAGAACG
TGGACATGCCACGGTTACACGACGTCATCGGAACACGCAC
TCTGTTGGTGCAGACGTTCTCCAGGTGTGTGTTGAGCTGT
GAGGAGGTGGACGATCTGGATGAGCTCTTGGCTACGAGGC
TGTTGTCTTTTCTCATGGATCACCATCAGGAAGTCCTGCA
GGTGCCTGTCTATCTGCGCAATGCTGTGGAAGATCACATC
AACTATCTCAAGTCACTGAGCTCGTGTCCTGGCTCTGCTG
GTCCTATACCATCATACTCGTTCTGCAGGCAGATCAGCTG
TCAGGAGTTTGAGCAGCAGAAGCTGTCAGTGTCTCAGTCT
GCTCTGGCTGACCTGCTGGAGAACATCATCAAAGACAAGA
GCATGTCTGTCAAAGAGAAGAAAAAGAAGATTAAACTGTT
TCAGAAGGAATATCCTGACATTTACTCCAGACGTTTTCCC
ACAACAGAGAGTGAAACTCAGCTTTTTGCAGACAAACCAA
AGATAAAGCCGCCAATGCTTTTAAGCATCAAAAAAGCCAA
AACCTTCAGTATTCGAAACTGAATACCTCTTAAAATCCTC
CTTTTTGAATGATGTTTGAGTAAACTGGCTGACACTTGAT
CACATCAATATAACTGTAACTTCAGTTGAAGTGTTGTTTT
TAGTTTCTTGTGGGATTTTCCTTTGAGTGAAGTATTTTTA
TTCTGTTTTTTTTTCTGTTTCAGTAGAGACGTCTGTCAGT
TTTAATGTTATTTATTTAAGATGTGATTGGTTGTAAGTTT
TAGATTTTCATAGTGTCAAAGTATATCCAAACCCCACAGT
AAATATATGCAAAGAAACCTAACATACTGTTTACATGGAA
AAATGAAGATTTCATATTTAAACATTTTGTAACGTTGTTT
ATTTCTCCTTTTTAATCTTGTGTTTTCCTGATATCACATT
TTTTGTGTGTGTGTTCACCATACAAGTGCACCAATTTCTA
AAAACATTTTCATGTGATGTGGGAGTTTGCTAACCTCTAA
GCTAGTATGGGCTGATTTGCACTGTTTTTCCATCTAATTT
GTCTTATCATGTTGTCTTTCTTTTAGTACATATTTTATTT
TTAGTCAGAACAATCTACTTATTGCTTATTTGTATGTATG
GATAATCTTGTCATTCAGTCACAATACTGATCCAGTGGCT
TGATTATTAAGAATGGGAAAAACTTGGACAGAGAGATTTA
TCTGGTTTTAATGTCGAGAAAAAGTGAGCCAAAAATTTTG
TTGTTTACTATTTTACTGTGTCACCTCAGATATGTATGCT
GTTCCTGATCTATGCAATAAACTTTTAAAACAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations