ZFIN ID: ZDB-TSCRIPT-090929-7855
Transcript Name: gclm-002
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000025080 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000025080|OTTDARG00000020151|ZDB-GENE-030131-5906 gclm|no_translation gclm-002 LG_ BX005425.12 Danio rerio protein_coding KNOWN, 525 bp
GTTGTAGTGTTGCTAGACATCCTTTCACAGCATTTACCTA
GACATTTGATTTTTCGTGAATGATGTGGAATTTATGGTTT
CATATTTTGGTTTTCGACGAATATGTCCAATTATTGAGTG
TACTAATGTGTAATTCGATTGTGCTATTTTGTAATTGGAT
TGATGATACAACGTTAAAATTTCTCTTTAGCTTCAAGACT
GCATTCAAGGCACATTGAGCGAGTGGTTCACCGCAATGCC
GTCATCCCTTGACTCTGAGCTTCCCAGTGTTTTGGACTGC
AGCATTCCTGAAAACACAGAGGCCATCACTCCAGAGGAGA
GAGAGGAGCTGAAGGTGTCCGTAAAGCTTTTTCTCACTGA
GTGGGACTGCTCATCCATCAGAAGTGCGGTAGACATGGCT
TGCCTGTCGTTAGGTGTCTCTCAGTTGGATTCTGTGATCA
TCGCTCCTCCTTCTCTTCCCGAGGGTGAAAGCCAGACACT
GACACACCTGCAGCCTCTCTGGCAGGAGCTGGAGAGTCTG
GTGCA

gclm TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA gclm-201 (1)    Ensembl 1826
ncRNA gclm-002 525
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
gclm-002 Contained in:
[BAC] DKEY-7O6 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000025080 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:CB364293 (1) 529 bp
CITATIONS (1)