ZFIN ID: ZDB-TSCRIPT-090929-7756
Transcript Name: bcap31-201
Previous Name: bcap31-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000024978 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000024978|OTTDARG00000020087|ZDB-GENE-030616-63 bcap31|OTTDARP00000020568 bcap31-001 LG_ CR450685.13 Danio rerio protein_coding KNOWN, 1113 bp
AGTGTGAAGTGCAGTCAGAGTGCACCAGAAGTTTTGACAG
ATTCCTGCAGGCCTTTCCGCGAATATTTCTCATTTTACTT
CAAATTAAACTTCCAGGTAGCCGTCATGAGTCTTCAATGG
ACGGCTGTGGCGACATTTCTATATGCTGAGGTGTTTGCTG
TACTGCTACTGTGTGTCCCGTTCATCTCCCCAAAACGATG
GAGCAAATTTTTCAAGTCCCGGCTGGTCACTGCCATTACG
AGTTATGGAAACACTGCATTCATTGTCATCATTTGTATTC
TTGTCTTTCTGCTCATAGATGCATTTAGAGAAGTGAGAAA
ATACAGCGTGGCAGAGAAAGTGGATCTGAGCAACAATCCT
GTGGCCATCGAGCACATCCACATGAAGCTGTTCAGAGCCC
AGAGGAACGAATACATCGCTGGCTTTGCTCTGCTTCTGTG
TTTGCTGTTGAGACGTCTGGCCACACTGCTGTCTCAGCAG
GCTACACTGATGGCCTCTCATGAAGCCTTCCAAAAGCAGG
CGGAGGGAGCAAATGATGCCGCCAAGAAATACATGGAGGA
AAATGAGAAACTGCAGGAGAAACTGCGGCAAGCCGGTATT
GAAGTGCCTGAAGTGGGTGGAAAGGCCAAAGGTGGCGTGG
AGGAGGACAAGAAAAATCTGAAGGAAGAGGTCAGGCAGCT
GAAGGACGAACTCGACGCAACCAAGAAAGCTCTTCAGAAG
TCAGACAGTGATGTGAAGGCCATGAAAAAGCAGGCTGAGA
ATCTGACCACAGAGTATGACCGTCTGCTGGAGGAACACGC
CAGACTGCAGGCCAAATGTGATGCTCAACAGGACAAGAAG
TCCGACTGAACGAAGCCCTTCATGCTCTGCTCCCTGTCCT
GCGTTCTCATTGGCTGTCAGCAGCGTCGCTCTTCTGGCTG
TGTAAGAACAGGGTTCCGTTCGTCAATAATGTGCTTTCGC
TTCATTCATTAAAGCCTGTTGAGGCTTTTCACACACTGTA
TCAAGTTTTCTCTATATTTTTGCTGTGAACCTAGGGTGGT
TAATTTGTGTTCCCTGTGTTTAGTCAAAACTTGTTTAGGT
TTTATGTTTTGATTAAATAACTGTTCAAAACTG

bcap31 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA bcap31-201 1113
ncRNA bcap31-002 (1)    Ensembl 716
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
bcap31-201 Contained in:
[BAC] DKEY-83K24 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000024978 (1),  Ensembl_Trans:ENSDART00000066107 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC049014 (1) 1138 nt
GenBank:BM957444 (1) 683 nt
CITATIONS (2)