ZFIN ID: ZDB-TSCRIPT-090929-15559
Transcript Name: bcap31-002
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000034861 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000034861|OTTDARG00000020087|ZDB-GENE-030616-63 bcap31|no_translation bcap31-002 LG_ CR450685.13 Danio rerio protein_coding KNOWN, 716 bp
AGTCAGAGTGCACCAGAAGTTTTGACAGATTCCTGCAGGC
CTTTCCGCGAATATTTCTCATTTTACTTCAAATTAAACTT
CCAGGTAGCCGTCATGAGTCTTCAATGGACGGCTGTGGCG
ACATTTCTATATGCTGAGGTGTTTGCTGTACTGCTACTGT
GTGTCCCGTTCATCTCCCCAAAACGATGGAGCAAATTTTT
CAAGTCCCGGCTGGTCACTGCCATTACGAGTTATGGAAAC
ACTGCATTCATTGTCATCATTTGTATTCTTGTCTTTCTGC
TCATAGGTGAGATTGAAATCTGAACTTTTCCATTAAACAG
TCTTCAGAAGTCAGTGTTGATCATGAAGAAGATGTTAAAT
TAAAAATACCACTCGCACCATTCTCATTTGCTACTACTAA
ATTGCGAAAGTGGGTCATTTAGAAATGATTGCTGCGCTGA
TTTCATAACATACTCATTGGCATATGACTATCTGTATGTA
CATAGCCAATTTATTGCACTATCTAGTATTAAGCAACTTG
GCAGAGAAGGTTAGTTACAAGAGATCAACAAATTGCTTGT
TTTAAAATGTTTTTTTCCACAGGTAGGATGAATTGCATTG
ATAAGAAGTCACAGTAATGATATTTATAATAATACAAAAT
ATTTTGTATTCAAGCACATGTTATTGAACTTTCTTTTTAA
TCAAAGGATCATTAAAAAAATGTGTTGAATTTTCCT

bcap31 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA bcap31-201 (1)    Ensembl 1113
ncRNA bcap31-002 716
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
bcap31-002 Contained in:
[BAC] DKEY-83K24 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000034861 (1),  Ensembl_Trans:ENSDART00000133137 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EH491749 (1) 745 nt
CITATIONS (2)