Transcript

nbas-202

ID
ZDB-TSCRIPT-090929-768
Name
nbas-202
Previous Names
  • nbas-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000006558 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000006558|OTTDARG00000005989|ZDB-GENE-041014-367 nbas|OTTDARP00000005841 nbas-002 LG_none BX649264.4,BX649438.3,BX649299.5,BX649472.15 Danio rerio protein_coding KNOWN, 737 bp
CAGGTGCTGCAGGGACTCGGCCGTGGAGTTGATGTTCAGA
GGTTTAGCAGTGACAACCAGTACAAAAAAGAGACTATTCT
GGGCCTGGCTGAGACACTGGATGAGAATGTGTACAGCATC
TCTCGTTCTCTGGCTCACCGCTACAGCATTCCACTCTGGG
AAGTGCACATGACACACCTTGAGTTTCTCTTCACTGATAG
TGGTCTCTCCACCAAAGACATCGAGGGCAGGACGGAGGCG
CTGGGTCTGTTTGAGACTCTAAAGACAGACCCGGAGTCGT
TTTACATGCACATGACAAAATACGTGTACCCCAGTATAGC
CGGGACCGACCAGCTCCGACTGCTCTTCTACTTCACTCTT
CTGGAGAACTGCGGCTGCGCAAACTACTTCTCACAAACTG
CTATGAAGCCTGACACACACCTCAAACTGCTCAAGAAGCT
CAAAGCTGTGGCTGTAGGTGAGTAGAGCTCAAGTCTGAAT
GTACAAAACAGATTTCACCATGTCCAACCTAGCACCCTAA
AGCACAAAACACTGACAAAGGAAACCAGTGTGGACAGTCA
TCCAATTACAGTAGGTCACTTTGCAGATGGTCAGTGGCCT
AGTAAGTGCCAATTGAACATTTTTAGTATTCAAACAGACA
CCATTTTTGTTTCTGTTTGTCAGAGTGGTCCCACTTTATA
TTTGGTGGCCTTTACTACAGTATGTACTTGCATCAACAAA
TAAATACCTCGTACTAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations