ZFIN ID: ZDB-TSCRIPT-090929-7674
Transcript Name: pax3a-202
Previous Name: pax3a-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000024890 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000024890|OTTDARG00000020032|ZDB-GENE-980526-52 pax3a|OTTDARP00000020502 pax3-001 LG_ BX085193.16 Danio rerio protein_coding KNOWN, 2713 bp
AATCCACAACAACAAGTGTGTCAACAACAACGGAACCAAG
CTTTGAGAGTGTTATCTTCCAAACCGCTTTGAGATAAACC
ACGATTGAAAACCTGGATATCCGTGAATAACTTCAGAGGA
CTGGAAGCGACGGTTTGACTTCTGAAGTTGACTTTTTGTT
TTCGCCTGAAGACCTCAATACTTGGGCAGTCCACTGACAC
TTGACGACTAGCGCTTTCTCTTTGGATAACTTTTTCTATC
AAGTGCTTCGTGCATCCTTTTTTCGTGCAGAGGAGATATG
ACCGCATTAGCGGGGGGCATTTCCAGGATGATGCGCCCCA
CGCCACCCCAAAACTACCCGAGAGGTGGCTATTCCTTGGA
GGTCTCTACGCCTTTAGGTCAGGGCCGCGTGAACCAGCTC
GGCGGAGTCTTCATAAACGGGCGCCCTTTGCCCAATCACA
TCCGCCACAAGATAGTAGAGATGGCCCATCACGGCATACG
ACCGTGCGTCATCTCCCGGCAGCTGCGAGTCTCACACGGA
TGCGTGTCCAAAATTTTATGCAGGTACCAGGAGACCGGTT
CCATTCGGCCCGGGGCTATTGGTGGCAGCAAACCCAAGCA
GAGCACAACTCCTGACGTGGAAAAGAAAATCGAAGAATAC
AAGAGAGAAAATCCAGGGATGTTCAGCTGGGAGATTCGGG
ATAAACTTCTGAAAGATGGAATCTGCGATCGGAATAACGT
TCCTTCAGTGAGTTCCATCAGCCGCATGCTGCGCTGTAAA
TTTGGTGGAAACGGAGATGAAGATGAGGATGACGATGAAG
TGGAGAAAAGAGAGATTGAAGAAAACGAAAGAAGAGCCAA
GCACAGCATCGACGGAATTCTTGGGGACAGATCAAGCCAC
TCTGATGAGGGCTCAGATGTGGACTCAGAGCCTGGTTTAC
CATTAAAGAGGAAACAGCGGCGCAGTCGGACCACGTTCAC
AGCCGAGCAGCTAGAAGAGCTGGAGAGAGCCTTCGAACGC
ACACATTACCCTGATATTTACACCAGAGAAGAGCTCGCCC
AGAGAGCCAAACTCACAGAGGCACGAGTGCAGGTCTGGTT
CAGTAATAGACGAGCTCGCTGGAGGAAGCAGGCGGGAGCC
AATCAGCTTATGGCATTTAATCACCTGATACCTGGTGGTT
TCCCTCCCTCTGCCATGTCGAGTCTACAGCCTTATCAGCT
GGCGGACTCTCCTTATCCTCCGTCGTCTATTTCACAAGTC
TCGGAACAGCCCAGCACTGTGCACAGGCCCCAGCCTCTTC
CCCCCACCTCAGTGCATCAGTCTGGGCTTGGCAGTGGACC
GGGGGCCCAGGAGGGGAGTTCGGCCTACTGCCTCTCCTCT
GGACGTCACGGCTTCTCTGGTTACTCAGATGGATATGTGG
CCGCACCGGGCCACGCAAACCCAGTGAACCCCTCCATCAG
CAACGGCCTCCCATCACAGGTGATGGGGCTGTTGAATCCA
GGCGCAGTTCCTCATCAGCCGCAATCTGATTTCGCCCTGT
CTCCGCTGACGGGCGGTTTGGAGCCCAGCACAGGCATGCC
CGCCAGCTGCCACTCCTCTCAGAGACTGGAAGCTCTGCCA
GGCCTTCCCAGCATGCCAGCTCTGCCCAGCTCCCAGTCCT
ACTGCCCGTCCAGCTACAGTTCACCCGGGTACAGCGTCGA
CCATGTGGCGTCTTACCAGTACAGCCAATATGGGCAGAGC
AAGGTGAATACCAGCACTGTTACTACTGTAGAAAGACTGT
CACGTGTTTATCCTCTAAAAAGGGCTTCATTTGGATTGGT
GGAATAAAGCAAAATATTACTTAATTGAATTGCTCTCAAT
AATGTCAGAAGATTATTTATGTTCATGAGACTTTGTCAAA
ATTTTTTGCAACATACTATGTAGTCTTAATTATGTGGAAA
TTTTTACACAACATTTACATCATTTTAACCAAAGAACCAA
AATGCAATTAGCCACCTTGTTCAAATCTATATGATATTTT
GGAAAGATGTTCTACTTGGTTATACACTGTAAAAAGTGAT
TAGTTACTTGATTAAAAAAAAAAAAAATTGAGGTAACCTG
TTACCTTAAAAGTGACAAGTTGACTTTGAGTAAACCTGTT
GTAACGCAGAACTGTTATTATTACTCACATAGTTCATTTA
CCTAAATTTTTTTAACCTCTTAAGACCAAAGGTGTTTTTT
TTACATGCATTTTTTATTTCTCTTTGCTATTTGGGCTCAT
TGGAACCTAATTAGAATAAAAACCTAAGTATCATCTTTTG
ATATGATTATATGTGGACCGAATTTACATAAAACACTTTT
TTTCTGAATGTTTTTTAATGCATATTTAACATCTAATTTT
TTTGGACATGTTTTGACTATCAGAGAGTAAAAACAACATT
CCTTTTTCCATTTTGGACACTAAAAATAGTGTTTCAGGCA
GTTCATATGCCGCAAAACAGTTGCAGTATGGCCCTGTATG
CAGTATGGCCACTGAGTTGCAGTATGGTCTGTAACAAAAT
ATAAAACATTCAAAGTATTTTAAATTGCCACTTCAGAGCT
AAAATGTGCGGTCCACGTATAATAGTAACAGGTTCACTCA
CTTTTTTAAGTCAACTAATTCCTTTTTACAATATCAAAAG
CGACAGATTATTTTCATTATTCTGACATATGTTTGGGTGT
TAACAAACATTGAAATAAAACAAATTAAAATAT

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
pax3a-202 Contained in:
OTHER pax3a-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000024890 (1)
  • Ensembl_Trans:ENSDART00000038828 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AF014366 (1) 2734bp
    GenBank:BC076069 (1) 1809bp
    GenBank:CK360749 (1) 774bp
    CITATIONS (2)