Transcript

shank2-201

ID
ZDB-TSCRIPT-090929-7623
Name
shank2-201
Previous Names
  • shank2-001
  • si:dkey-221m4.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000024834 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000024834|OTTDARG00000019995|ZDB-GENE-061207-58 shank2|OTTDARP00000020462 CH211-51L3.7-001 LG_none CR382374.13,BX005373.15,AL929309.6 Danio rerio protein_coding NOVEL, 5411 bp
TTTGGATCATGCCGCGGAGCCCCATGTCTAGTGAGGAGGA
AATGGCTCAGAGTTTTTCCGACTCGGTCAGTTCAGACTCA
GACAGCTCCCGAGATGAGCCTCCGAGGCTGGACCGACCGA
CCAGTGGCCGTCAGGACAACAACACTACGCTTATCTGTGT
GGTCATCCCTGACCTGCAGCAGTCTAAATCCATGCGCTTC
AGTCCTGATGCCACCGTGTGGGTTGCTAAGCAGCAGATCC
TGTGTACCCTCACCCAGAGCCTGCGGGACGTGCTCAACTA
CGGCCTCTTCCAGCCGGCGGTGGACGGCAGGGAAAGCGGA
TTCCTGGAAGAAGAGCGGCTGCTCAGAGACTATCCGCTAT
CCTCCACTAAAGGCATCCCCACTCTTGAGTTTCGCTACAA
GAGCAGAGTGTACCAGCAGCCAAATGTCAACGAAAAGCAA
ATCGAAAAGCTCCACACACAGGTCAACCTGAGGAAGTTTA
TGGAGTACATTCAGCATCATCAGGTGGAGAAAGTGGCCAA
GATGTTGGAGAGAGGGCTGGATCCCAACTATCATGACCCT
GATACTGGTGAGACCCCGCTGACCCTTGCTGCTCACTTGG
ACAATATGCTGGAGATTATAGTGACTCTAAAGAACGGCGG
GGCTCATTTGGACTTTCGCTCCCGGGATGGCATGACTGCC
CTGCACAAAGCAGCCAGAGCCAAAAACCAGATCGCTCTCA
AGACAATGTTAGATTTGGGAGCATCTCCAGACTATAAAGA
CCGGCAGGGTTTGACCCCGCTGTACCACACGGTGACAGTA
GGTGGCGACCCCAGCTGCTGTGAGGTCCTGCTGCGTGCCC
ATGCCAGCGTCGGGTGCCATGATGAAAACGGCTGGCACGA
GATCCACCAGGCATGTCGATACGGACACGTCCAGCATCTG
GAGCATCTGTTGTTTTACGGAGCGGACATGCATGTGGAGA
ACGCGTCTGGAAACACAGCTCTTCATATCTGCGCTCTTTA
TAAACAGGAAAAGTGTGCCAGGGTGCTTTTGGTCCGCGGT
GCAAGTAAAGACGTGAAGAACTATCGAGGACAAACGCCTT
TTCAGGTGGCAATAATTGCTGGAAATTTTGAGCTTGCAGA
GTTCATAAAGAACCACAAAGAAGCTGATATTGTGCCTTTC
CGGGAGGCACCGGCAGGCACAGGACGGAGCAGGCCGTCGC
AGCAATCGCCGCTGCAGCACCAGGGTAGGAGTACTCTTGC
CGCCCCGCGAGTGCTGCTCCGATCCAACAGCGACAACAAC
CTGAACGTCAACAAGCTGTCGCTGGAGCGCTCACGCTCGC
CCTCTCCTGCCGCTTCACCCCTGCGCAGCCTCTCGCCCCG
CCACCCCCAGCAGATGCAGAACAGCCCAAATGGCACGGTG
AAAACCATGGCCCTGGGCGGGCGCTCCGCCCGAAGCCGAT
CCCCTTCCCTGGGCCGGCTGGGGGAGGGAGACACGCGGAG
ACAGACCCCGCTACGCCACAGCAGTCCGCGTGCCAACAGA
GATGCCTTTTCCGGCATAGAGACCCCCGGGTCCAAACGGA
AGCTGTACAGCGCTGTGCCAGGAAGACACTACGTGGTGGT
CAAATCATACCAACCGCAGGCCGAGGGAGAAATCGTTCTT
TACAAGAACGACAGGGTCAAAGTTCTCAGTATTGGAGAAG
GAGGATTCTGGGAAGGCAGTGCCCGAGGGAATGTAGGCTG
GTTCCCTGCGGAATGTGTGGAAGAGATCCCGAGCAAACCC
AACGAGGACAGGCCCTATGCCAGAGCGGACCGTTCAGAGA
GAAGGAAGCTCTTTCGACACTACACTGTGGGATCTTATGA
CAGTTTTGATGCATCAAGCGACTGCGTTATCAACGAAAAG
ACTGTCGTGCTGCAGAAGAAGGATAACGAGGGATTCGGGT
TCGTGTTGAGAGGGGCGAAAGCGGATACCCCCATTGAGGA
GTTCACTCCCACTCCAGCCTTCCCTGCGTTACAGTATCTG
GAGTCTGTGGATGAGGGAGGGGTGGCATGGAAAGCTGGTT
TAAGAACAGGAGACTTCCTCATCGAGGTGAACCAGGATAA
CGTTGTCAAAGTGGGCCACAAACAAGTGGTCAACATGATT
CGTCATGGTGGCAACCACTTAATCATCAAAGTGGTAACGG
TCAGTCGAAATCTAGACCCTGACGACACGGCTCGAAAGAA
AGCGCCACCGCCACCACGGAGGGCTCCCTCCACAGCCTTG
TCCATGCGTTCAAAATCTATGACCTCAGAGCTAGAAGACC
TAGATAAAGTGGATGAAGTCGTACCTCCTCAGAAACCCAT
ATGGGACAACTCAAATGCAGAAGTGAGAGTGGCGACGGTC
AAGCCACGTCCAACTAGCAAATGTTTTCCTGTCAGCCCTG
AAATGAATTCTCTCTGCAATAGTCAGGATACAGCAGTAGA
TTCGTCACCACAGCCAGGGAGTCCTAGAGGCCCTTTTCTG
GGTCTACCAAGGGGAACCATACGGCGGCAAACATCCATAG
GAGTAACCGAAGAAGAGAAGCAGTTCCTTACTCCTCCAAT
GTTGAAATTTACAAGAAGCCTTTCGATGCCTGACACATCA
GAGGATATTCCACCCCCACCAGCTATCTCCCCTCCATCTC
CACCTCATAATAATGCTCCTGTCCCAGCTGGTCGAGGATA
CGGCACCATCAGAGCAGGTTTTACTTCACAGAGTCCTAAT
GCAAACAGCACAGCCCCGGAGAGAGGAGAAGGTGCTGGGT
GGAGAGATCAGGGCAAGTATTACAGAGACAATCCCGAGCA
GTATGATTCTGAGGGGTACAATCACAGCCCCACGGCCCAG
CAGAGTCTTCATATGCGCCGTGCCCAAATCCCTGAGAACC
CTTACTCAGATGTTGGTAAGATGGGTCAAGCTGGACTGTT
TGTGCCCAACAAGCCTGCCAGAAGAAAGGGAATGCTTGTC
AAACAGTCCAACGTAGAGGACAGTCCTGAGAAGACCTGCT
CCATTCCTATTCCGACAATAATAATCAAAGAGCCCTCCAC
CAGCAGCAGCGGCAAAAGCAGTCAAGGAAGCAGCATGGAA
ATTGAGACGACCACTCCAGATCACCCAGGGCAGTTGCGTC
CTGAAGATGGCCTAAATCCAGGCAGTCCATTTGCAGCTGC
CATTGCTGGTGCTGTCAGAGACAGGGAAAAAAGGCTTGAT
TCTCATCGCAACTCACCATCTTTTAGGTCTACAGATGCTG
GTGATGAAGATGTGGTTCCTACACCTACCCCAAGGCTTCG
ACACTCCAAGTCTATTGATGAGGGCATGTTTAGCAGCGAT
GAGCGGCTGCGTAGGCTCATGGCACCTCCCTCATCACTTC
TTAGCATCCCTAGAGGTGGTGGCAATGTGACAGACTTCAA
CAGTCCCGAACCCACCATGGTAAGGGAACTGTTGAACACT
CGTACAGGACACAGCCCAATCAGTCTGCCTGCTCATAAGA
CCTACAGCTCAGGAAGTGGGAATTACGTTCACCCAGTAAC
AGGCAAGCCACTTGACCCCAACTCACCATTAGCTTTAGCA
TTAGCTGCCAGAGACCGAGCCATGAGGGATCAATCACAGC
CTCTTCCATTAAAAAGTGACCCATCCAAACTTGATCTCAA
TAAACCGCTTTTCATCGACACCAAGCTTAGACCAAATGTG
GAGGTTGGCTTCTCAAGTACTGCTACCATGGGCCGTCCCC
GTGGGGGCTTGAGGAGGCAGATGACTGAGTCCAAATATGA
GACAGAATCCAAGTATCAGCTCGATTTGGGCAAGCCCGAA
AAGAGGCCTGAGGAGAAGAAAAACATGCTGATTGACATTG
TGGACACTTCTCAGCAGAAGTCAGCTGGTCTGCTGATGGT
GCACACCACAGATGGGGCAAAATCTGAGGATAACAGCTTG
TCAGAGGGCGAAAGGGACGAGGGAGTGAGTCCCGACAACA
CCCCTGGGGAGCTTCGCGACCCCAACCAGCCAGCTCCCAC
CAACCCCCCAGCCCCCAAGGCGCTATCAGCTGCTCCACAT
GGCAAGACCATTATAACTGTTAGCTCAGTGGATGAGCCTG
TGAAGCTGCCCTTCGGCATCCCTCCACCGCCCTTGGCCTC
TGTCGACATCGATGAAGAGTTTGTGTTTGCAGAACCCTTA
CCACCCCCACTGGAGTTTGCCAACAGTTTTGACATTCCTG
AAGACCAGGCAGGAAGTATAGCTGAACTACTCAAACAGAA
AGCAAATGGTACAAAAGGGCCTTCTCTTGCTCCCTACTAT
CCCGCGTTAGGTGGAGGGCATGCTGAAATCAAAAGATCAA
CAGTCCTCACAAATTGCACACCTCCCAGCTTCCCTCCTGG
GCCTCTAGAGCCCTATGAACAAATCACTGACTCGGGCATT
GAGGTAGACAGCCGGAGCAGTGGTGACCCCCAACTGGAGA
CCACCAGCACCATCTCTACTGTGTCCAGCATCTCCACCCT
GTCTTCTGAAGGAGGTGAGACCCTGGATACGTGCACCGTC
TATGCAGATGGACAAGCCTTTCTGGTGGACAGGTCTCAAA
TCCTGTCTAAACCAAAACCCAAACCTGCCATCAAGAGCAA
TGCACTTTACAAGGACTCTTTGCCTGAGGAGAACGTAGGC
TCTTTCAGAATGCCCTCCTCTGTCCCACCTCCACCCCCTG
GATCTATTCCACCAGAACCCTTGAAAACCCCAACGCAACG
AACCTCAAAGCTGTGGGGTGACCCTCCGGAGATGAAAGGA
CCCCATGGGCCTGAAACCAATTCAGTTCTGCAGCATGTGA
ACAAGGACAAAGCACCAAAGCCAGGGGAAGCGTTAGACTC
TCCGACTGGATCCAGGACTCACTTTGGAACAAGAAATCAG
GATGGTGTATCCCTCATCTCAGGTACACAGCAAAACACCA
CCGTTACCTTCACTGCCCAGCCTGGCCCCAACGTGCCTGC
CCCGTCACCGTGCCGACAGGCAGAGAGCCTGCCTCCCCAC
CACCACACCCCAAGCCCTATCATGTCCCCACCGGACTCTG
GCCTCAGCTGTGCCTCTTCCCTCCCAACCTCGGCCACTTC
CCCCACCATGACGGACGTCTTTGGCCTGCCCACACCGCCC
CTCAGCCTGGGCACAGGGCGTAGCCGCTCCCCTTCCCCAC
TCACCCTCATCCAGGCTGCATCAAATAAGCCCTTTGCCAC
CAAACCTGTTCTCTTGTGGAGCAAGCAGGATGTGGCCGAC
TGGCTCGAGAGCCTGAACCTGGGTGAGCACAGGGATGCCT
TTATGGACAATGATATAGAGGGCAGCCACCTGCCAAACCT
GCAAAAGGAGGATCTGATCGACTTGGGTGTGACTCGTGTG
GGTCACAGAATGAACATCGAGCGGGCGCTTAAAGTCCTTT
TGGACAGATGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations