Transcript

nrp1b-202

ID
ZDB-TSCRIPT-090929-7614
Name
nrp1b-202
Previous Names
  • nrp1b-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000024823 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000024823|OTTDARG00000019989|ZDB-GENE-040611-1 nrp1b|OTTDARP00000020453 nrp1b-001 LG_ BX088727.14 Danio rerio protein_coding KNOWN, 1387 bp
AGTCTTCATATCGGATGCTGACACCTTCGCACTAGTGAGA
ACCTGCTAAATATACCCAGCAGTGCCCGTGTACGCGCGAC
ACAGAGGACGGAAATCAGTCATATATTAGGGAGTGACCCG
ACTGCTGAAGCGCCCGCAGACAGCGAGCTGAGCCCAGGAC
GCGCTGTCAAGCATCTCCAACACTTCGGATTATGAAATTG
AAGCAAACACAGCAGTGGCGGTGACTCTACGAGAATCTCC
CGCTTTCCAGGGTTGTGAGTTTTCATCTTCGCGTAATGGA
AGAGGAGACCGCGGCTCCCTGGCTCTGAGTGACAGGATCT
TTCCACAGCTTCCCAAAACTACAGGATTCAACAATAATTA
TTCACACTAATTGCTGAGGATATATCTGAAGAGATTTCGT
TTGAGGATGTACTGGTGTTTGCTCTGTGTGACTCTAACGG
GATTGTCCGTGGCTCGCGCTCTGACGGATCGTCCCTGCGG
TGGGAAAATCACAATCACCAGTGCCGGGTATGTGACCTCT
CCCGATTACCCGACTGGATACCCAGTGAACAAGCAGTGCA
CATGGCTGATCCAGGCTCCTGATCCACAGCAGAAGATCCT
CATCAACTTCAATCCGCATTTTGACCTGGAAAGCCGGGAA
TGCAAGTATGATTTTGTACAGGTGTTTGATGGTGCGGATG
AGAACGCTCTCTCTCTTGGGAGGTTCTGCGGCAAAATCGC
TCCGTCTCCGATTATCTCTAGTGGAAACTCTTTACTCATC
AAATTCACCTCCGACTACGAAAGCGCAGGAGCCGGATTCA
GCATCCGCTATGAGATACACCGTACAGGTACCGAATGTTC
CAGAAACTTCACCGAACCGCACGGACTGATCGAAACCCCT
GGCTTCCCGGATAAATATCCCAACAACCTGGAGTGCACCT
TCATCATCTTCGCGCCCAAGATGGCGGAGATCATTTTGGA
CTTTCAGAGCTTTGACATGGAGCCGGACACAACGGCACCT
GCGGGGGCCGTCTGCAGATTCGACTATCTGGAGATATGGG
ACGGATATCCTACAGTGGGTCCTCATATTGGTCGATACTG
TGGTTCCAGACATCCAGGTCGAGTGATTTCATACACTGGC
ATTCTCTCTCTCAGTATCCACACAGACAACGCCATCACCA
AAGAGGGCTTTTCAGCCAATTACAGCATCCGAAGCAGCTC
AGACCAACTTCAACCACACCAAGATGAGTGTATGTATCCT
TTAGGAATGGAAAGTGGTGAGATCACAGAAGACAGGATAG
CTGCATCGTCGCAGTATAATCCCAGCTGGTCTCGACTGCG
CTCCAGACTGAATTACCTTGAAAATGGCTGGACGCCGTCA
GAGGATTCTTCTCGGGAGTGGATACAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations