Transcript

slc39a6-202

ID
ZDB-TSCRIPT-090929-7609
Name
slc39a6-202
Previous Names
  • slc39a6-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000024818 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000024818|OTTDARG00000019985|ZDB-GENE-030131-3023 slc39a6|OTTDARP00000020449 slc39a6-002 LG_ BX324211.9 Danio rerio protein_coding KNOWN, 776 bp
CATTTACTTCGTGAAAAGACGTCTATATAATCACACCTAA
GCGGTTGCCAATATGATTGGCTGGTGGCCACGCCTCTGCC
CAGTGATGTCACTGGCACTGCTGTGGGCGTGTTCAGTGGG
GGCGGGTTCAGACTGCAAATCTGTGGCCATTGAGACTGAC
AGCCGCATAGCAGAACAAACACAGCAGCGTCACCTACAGG
CTCTGTTCGACAAGTATGGCCAGAACGGCAGCATCTCCCT
AGAAGGCCTCTTCAACCTACTTAAAGGGGTCGGGCTTGAC
CGCATCCGGAAAGTGATGGTGCATCATCCTGGAAATGCCC
ATAATCACACACACACGCATGATCACACACACACTCATGT
GGACAAACTCACGGCGCACACACATCCGGTCACCACCAAG
AAGGGAGACATGGATCACAGCGTGGAGAAGAGTGACCCTG
TCCCAAAAGCACAGCCAGATCCTGCCTCTGGGAAGAAAAG
CCAGTCAGATGCGCATCACAACCTGTACATGAAGATGAAC
CAGGAATCCACCACAGCTTTGACTACGCCGTCATATGTTA
CCAGATCACGGCGGACCAATCGCAGCGCCGATTATGATTT
TACACAGGACCACGCCTCCTTTAGCCCCAGTCAGCCCAAT
GTGACACACTCAAACCACACCCATCATGATGAGGACACGC
CCACACACCAGCATGATGACCATGATGAGCACGAACATGG
CCGTGCTAGTTTAGGGTGTCAAAATGCCTCCACGATCCTG
CAGACGCATGGCATGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations