Transcript

slc39a6-201

ID
ZDB-TSCRIPT-090929-7608
Name
slc39a6-201
Previous Names
  • slc39a6-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000024817 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000024817|OTTDARG00000019985|ZDB-GENE-030131-3023 slc39a6|OTTDARP00000020448 slc39a6-001 LG_ BX324211.9 Danio rerio protein_coding KNOWN, 2602 bp
ATGATGACGTTTCTTTGCACACGGTCTGGTCGCCGTGCTA
GTGGTGTGGAGTGCAGAATCGCCGCTGAACGCGCTTACTT
TCGAGCGCGTGGACTCCCGGTTGCCAATATGATTGGCTGG
TGGCCACGCCTCTGCCCAGTGATGTCACTGGCACTGCTGT
GGGCGTGTTCAGTGGGGGCGGGTTCAGACTGCAAATCTGT
GGCCATTGAGACTGACAGCCGCATAGCAGAACAAACACAG
CAGCGTCACCTACAGGCTCTGTTCGACAAGTATGGCCAGA
ACGGCAGCATCTCCCTAGAAGGCCTCTTCAACCTACTTAA
AGGGGTCGGGCTTGACCGCATCCGGAAAGTGATGGTGCAT
CATCCTGGAAATGCCCATAATCACACACACACGCATGATC
ACACACACACTCATGTGGACAAACTCACGGCGCACACACA
TCCGGTCACCACCAAGAAGGGAGACATGGATCACAGCGTG
GAGAAGAGTGACCCTGTCCCAAAAGCACAGCCAGATCCTG
CCTCTGGGAAGAAAAGCCAGTCAGATGCGCATCACAACCT
GTACATGAAGATGAACCAGGAATCCACCACAGCTTTGACT
ACGCCGTCATATGTTACCAGATCACGGCGGACCAATCGCA
GCGCCGATTATGATTTTACACAGGACCACGCCTCCTTTAG
CCCCAGTCAGCCCAATGTGACACACTCAAACCACACCCAT
CATGATGAGGACACGCCCACACACCAGCATGATGACCATG
ATGAGCACGAACATGGCCGTGCTAGTTTAGGGTGTCAAAA
TGCCTCCACGATCCTGCAGACGCATGGCATGAGAAAGGAA
GCAAGTCTCTCAGTTAAGGACTTCAGTTTCCTCTGCCCTG
CTCTTCTCATGCAGATTGATTCCAAGTCTTGCATCGTGCA
TGAAGACGAGGACGAGCATTCAGATCATTCCCATCATCAC
AAACACCACCACCATCATCATGATCACCAACACCTGCAGC
ATCCACATAACCACACCAATGGAAGAGGCCAGAGGAACAC
TCCAGTCTACATCGCATGGCTTGGAGGGTTTCTCTCCATC
ACTCTGATCAGTTTGCTGGCGTTGGTTGGTGTGGTTTTGA
TCCCACTCATGAACAGAGTTTGCTTCAACTTCCTGCTGAG
CTTCCTGGTGGCCCTTGCAGTGGGCACTCTGAGCGGAGAC
GCTCTCCTCCACCTCATACCACATTCTCAGGGTCATCACC
ATCACGGCCACTCTGAAGAGCACGCTGAAGAGGAGGACTC
CCTTCGCCCTGTGTGGACCGGACTCACAGCTCTAAGTGGA
GTTTACATCATGTTCCTCATCGAACACTTCCTGACCCTTG
GCAAAATGTACAAAGACAAAAACCAGAAGGTGCAGAAGAG
GGTTGATCTCACCACAGAAGTTTTGGAGTCTGAGAAACTG
CCATCATTAGAAGAAAATGATGTCAAAATTGAAGCTGCTG
AAACGAATGGTGGGCGTGCACTGGCAGAGGAGGAGGAGGT
GATGTTGGGGGCGGAGCTCTACAACGACATGGACTGCGAG
AACAAATGCCACTCCCACTTCCATGACACGGTTGGCCAAT
CGGATGAGCAGCATCATCATCATCACGACTACCACCACAT
ACTGCATCATCACCACTCCCAGAACCACCACCCGCACACA
CACACGCACAGACACACACACTCCTACTCGCAGCAGCACT
TTGAGCAGGCTGGTGTGGCCACACTCGCCTGGATGGTCAT
CATGGGAGACGGACTGCACAACTTCAGTGATGGACTTGCC
ATAGGGGCGGCTTTCACAGAAGGTTTGTCCAGTGGTCTTA
GTACCTCAGTCGCTGTGTTCTGCCATGAGCTTCCTCATGA
ACTCGGTGATTTTGCCGTCCTACTGAAAGCCGGTATGTCA
GTTCGACAGGCCATGCTGTATAATCTGCTGTCAGCACTGA
TGGGATATCTGGGCATGATCATCGGGATTCTCATCGGACA
TTATGCTGAAAATGTTGCCACATGGATCTTTGCTCTCACA
GCTGGGTTGTTCATGTACGTCGCGCTCGTGGACATGGTAC
CTGAGATGCTGCACAATGACGCGAGCGAAGCAGGTTTCAG
TCACTACGGCTTCTTCCTCCTGCAGAACGCTGGGATACTC
CTAGGCTTCGGCATCATGCTTATCATTGCTGTCTTTGAGG
ACAGGATCCAACTGGACTTAGGTTACTGACCAAAAACCTT
TCCTTCACACCTAAAGACATTAACAGAAAACATCCATTAT
CATTGCTCTTTAACCCCTAAATCACACTTACCTGAAATCT
AGCTGTTAAATGTCTCAAATCTGGTTTTGTCTGTAAAAAA
AAAAGGAGAAGAAAAAGTTCACAGTATTTTAATATGCACG
AATTGTCTTCTTATTTGTGGCTTGCAGGAGAGAGCAATAT
TTATTGTGTTGACTGTTATGATGCCAGTATAAAAGAGGAA
GGAGAATGTGGAGATGATTTTTATTTGTTTGTTACACAGT
GTTGTACAGTAGCTGAAGAGACATTCATTTTGCACATGTT
GTCCCTCCAACATTCCAGTAAAATATTGAAGAATTGAGTG
TC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations