header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-7604
Transcript Name: keap1a-201
Previous Name: keap1a-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000024813 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000024813|OTTDARG00000019983|ZDB-GENE-030131-556 keap1a|OTTDARP00000020445 keap1-001 LG_none BX927124.8,BX663525.6 Danio rerio protein_coding KNOWN, 2868 bp
AGAGCGAGTACGCGCCTGCTTCACAGTCAGTTGACAGCTG
GAAGGCAGAGAAGCTTCGCGCATAACAAACTTTCGATTAT
GTTTTTAGTTTTTTGCTTTGAGGTTTTACGCGCCAAAAAG
AGCAAGGTTTAGTTTGTAAATGCGAGCGGAGGGCATTCCC
CTCCTCGAGTATCAAATTCTTGTATTAATTCGAGCAGGAT
CAGTCTTTGTGTAAACAGTCTATGTTTACAGGACGTAAGT
GGAAGTAAGTGAAGTACTGTCACCGGTTCCTGATATAAGG
GTGAAAAGAGCACATCCTTCTCAGAGGATAATAACCTTTT
GGAAGAAAAGAATATTGCATTTTTATTGCATGCGCTTACA
ATAATTTGTAAGACAACTTCACTTTTACAATCTCAAGAGG
ATAAAATTGGATCTGTAATTGATGAAAAGTAGCTTTCGTT
TGATTTAAAGGAAGCAACGCTTTAATATCCTTTTACACTG
TGGATATTTCAACAATGCCAACCTGGCTGGAGACAGAATC
TTGTTATAGTGGACTTCTAACCAGACAGAAGAAACATGGC
TCTCTGTCCTTAAACGATAATCAGTTGTGCCTGTATTTCT
TCATGGCACGTGGATGGGTATAGACATTGTTCTGCTGCAT
TTGCCATTCATTTTCTACTCATAACAATTGACAATCAAGC
TCTTGGAGAATGATATGTCCAAGAAAGAAGAGGCCCATCA
AAGATGAGGATTTCTCCGCCATCGTGGTCCCCTCCATGAG
GGGTCACGGTTACTTGGATTACACGGTTGAAAGTCATCCG
TCTAAAGCTCTGCAGAACATGGACGAGCTGCGTCATCATG
AAATGCTGTGTGATCTGGTTCTGCATGTCACATACAAGGA
CAAGATAGTGGATTTTAAGGTGCATAAGCTGGTTCTGGCC
GCCTCCAGTCCTTACTTCAAAGCCATGTTCACCAGCAACT
TCAAGGAGTGCCACGCGTCGGAAGTCACCCTTCGAGACGT
TTGTCCTCAAGTCATCAGCCGTCTCATTGACTTTGCCTAC
ACCTCGCGCATCACAGTTGGCGAGACCTGCGTTCTTCACG
TCCTCTTGACCGCCATGCGCTACCAAATGGAAGAAGTGGC
CAAAGCCTGCTGCGATTTCCTCATGAAGAACCTGGAGCCA
TCCAATGTCATCGGCATCTCGAGATTCGCTGAGGAGATCG
GCTGCACTGACCTACACCTTCGCACCAGAGAGTATATCAA
CACTCACTTCAATGAGGTAACCAAAGAAGAAGAGTTCTTC
AGCTTGTCCCATTGCCAGCTGCTTGAGCTGATCAGTCAGG
ACAGTCTGAAGGTGCTCTGCGAGAGCGAGGTCTACAAGGC
CTGCATAGACTGGGTACGCTGGGACGCAGAGAGCCGTGCG
CAGTACTTCCATGCCCTCCTCAATGCCGTCCACATCTACG
CCCTTCCACCCACTTTCCTCAAAAGACAACTGCAGTCCTG
CCCCATCCTCAGCAAGGCCAACTCCTGCAAAGACTTCCTA
TCAAAGATCTTCCATGAAATGGCTCTCCGAAAACCCCTGC
CGCCAACACCTCATCGTGGGACGCAGCTCATTTACATAGC
GGGAGGTTACAAGCAACACTCTCTGGACACCTTGGAGGCC
TTCGACCCGCACAAGAACGTCTGGCTCAAACTAGGTAGCA
TGATGTCTCCTTGTAGCGGGCTTGGGGCGTGTGTTTTGTT
CGGGCTTCTTTATACAGTCGGCGGACGCAATCTCTCCCTG
CAGAACAACACAGAGTCTGGATCTTTGTCCTGCTACAACC
CCATGACTAACCAGTGGACCCAGCTGGCTCCGCTCAACAC
ACCCAGAAACCGAGTGGGCGTCGGGGTCATTGATGGGAGC
ATTTATGCTGTTGGGGGTTCACATGCCTCTACGCATCACA
ACAGCGTCGAGAGGTATGACCCAGAAACAAACCGCTGGAC
GTTTGTGGCCCCTATGTCAGTGGCGCGACTGGGGGCCGGT
GTGGCGGCATGTGGAGGTTGCCTGTATGTGGTAGGAGGGT
TTGACGGGGACAACCGGTGGAACACAGTGGAGCGATACCA
ACCAGACACCAACACCTGGCAGCATGTGGCACCTATGAAC
ACAGTGCGCAGCGGGCTGGGGGTGGTGTGTATGGATAACT
ACCTCTATGCAGTTGGAGGCTATGATGGACAAACCCAACT
CAAAACCATGGAGAGATATAACATCACTCGAGATGTGTGG
GAACCCATGGCTTCGATGAACCACTGCCGCAGTGCACATG
GAGTCTCAGTCTACCAGTGCAAGATTTTTGTGTTAGGTGG
ATTTAACCAAGGTGGTTTCCTGTCCAGTGTGGAGTGCTAC
TGTCCCGCCAGTAATGTATGGACGCTTGTAACAGATATGC
CCGTGGGACGCAGTGGAATGGGTGTAGCCGTGACCATGGA
ACCGTGTCCTGGTATCCTGCCAGAGGAGGAGGAAGAAGTG
GACGAGGAGATGTGACATTTCATCGTGTGCCATTTTAAAG
ACAGCACATACTGCAATTCCCTTCAAACTTGATTGTGCAT
GCACGAGATGCCAATGAGGACAAATGTATGTAATTTCAGA
TTGATTTTAAAGTTTATTTGGATCAATCCTCCCTCAGCTA
CAAAGTGTGTGCGATTTAGAGAGAGCAACATGGCTAATCA
CTGGACTAATGAAGTGGTGATCACTGTAGCAGGACTTTAA
ATGAATATCCTGTGACTGACGCACAGACACACGCACAATT
GTTTTGTCGAACTTCTGAATGTGTAATTTTGTGAGCTTGT
TATAAATACTTTTCACATCTGTAAATGCACTGTTTAATGT
GCACACCTGATAAAACACTCAAATCGCA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
keap1a-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000024813 (1),  Ensembl_Trans:ENSDART00000045763 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC117613 (1) 2888 bp
GenBank:AB081315 (1) 2701 bp
GenBank:AW153732 (1) 583 bp
CITATIONS (2)