Transcript

keap1a-201

ID
ZDB-TSCRIPT-090929-7604
Name
keap1a-201
Previous Names
  • keap1a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000024813 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000024813|OTTDARG00000019983|ZDB-GENE-030131-556 keap1a|OTTDARP00000020445 keap1-001 LG_none BX927124.8,BX663525.6 Danio rerio protein_coding KNOWN, 2868 bp
AGAGCGAGTACGCGCCTGCTTCACAGTCAGTTGACAGCTG
GAAGGCAGAGAAGCTTCGCGCATAACAAACTTTCGATTAT
GTTTTTAGTTTTTTGCTTTGAGGTTTTACGCGCCAAAAAG
AGCAAGGTTTAGTTTGTAAATGCGAGCGGAGGGCATTCCC
CTCCTCGAGTATCAAATTCTTGTATTAATTCGAGCAGGAT
CAGTCTTTGTGTAAACAGTCTATGTTTACAGGACGTAAGT
GGAAGTAAGTGAAGTACTGTCACCGGTTCCTGATATAAGG
GTGAAAAGAGCACATCCTTCTCAGAGGATAATAACCTTTT
GGAAGAAAAGAATATTGCATTTTTATTGCATGCGCTTACA
ATAATTTGTAAGACAACTTCACTTTTACAATCTCAAGAGG
ATAAAATTGGATCTGTAATTGATGAAAAGTAGCTTTCGTT
TGATTTAAAGGAAGCAACGCTTTAATATCCTTTTACACTG
TGGATATTTCAACAATGCCAACCTGGCTGGAGACAGAATC
TTGTTATAGTGGACTTCTAACCAGACAGAAGAAACATGGC
TCTCTGTCCTTAAACGATAATCAGTTGTGCCTGTATTTCT
TCATGGCACGTGGATGGGTATAGACATTGTTCTGCTGCAT
TTGCCATTCATTTTCTACTCATAACAATTGACAATCAAGC
TCTTGGAGAATGATATGTCCAAGAAAGAAGAGGCCCATCA
AAGATGAGGATTTCTCCGCCATCGTGGTCCCCTCCATGAG
GGGTCACGGTTACTTGGATTACACGGTTGAAAGTCATCCG
TCTAAAGCTCTGCAGAACATGGACGAGCTGCGTCATCATG
AAATGCTGTGTGATCTGGTTCTGCATGTCACATACAAGGA
CAAGATAGTGGATTTTAAGGTGCATAAGCTGGTTCTGGCC
GCCTCCAGTCCTTACTTCAAAGCCATGTTCACCAGCAACT
TCAAGGAGTGCCACGCGTCGGAAGTCACCCTTCGAGACGT
TTGTCCTCAAGTCATCAGCCGTCTCATTGACTTTGCCTAC
ACCTCGCGCATCACAGTTGGCGAGACCTGCGTTCTTCACG
TCCTCTTGACCGCCATGCGCTACCAAATGGAAGAAGTGGC
CAAAGCCTGCTGCGATTTCCTCATGAAGAACCTGGAGCCA
TCCAATGTCATCGGCATCTCGAGATTCGCTGAGGAGATCG
GCTGCACTGACCTACACCTTCGCACCAGAGAGTATATCAA
CACTCACTTCAATGAGGTAACCAAAGAAGAAGAGTTCTTC
AGCTTGTCCCATTGCCAGCTGCTTGAGCTGATCAGTCAGG
ACAGTCTGAAGGTGCTCTGCGAGAGCGAGGTCTACAAGGC
CTGCATAGACTGGGTACGCTGGGACGCAGAGAGCCGTGCG
CAGTACTTCCATGCCCTCCTCAATGCCGTCCACATCTACG
CCCTTCCACCCACTTTCCTCAAAAGACAACTGCAGTCCTG
CCCCATCCTCAGCAAGGCCAACTCCTGCAAAGACTTCCTA
TCAAAGATCTTCCATGAAATGGCTCTCCGAAAACCCCTGC
CGCCAACACCTCATCGTGGGACGCAGCTCATTTACATAGC
GGGAGGTTACAAGCAACACTCTCTGGACACCTTGGAGGCC
TTCGACCCGCACAAGAACGTCTGGCTCAAACTAGGTAGCA
TGATGTCTCCTTGTAGCGGGCTTGGGGCGTGTGTTTTGTT
CGGGCTTCTTTATACAGTCGGCGGACGCAATCTCTCCCTG
CAGAACAACACAGAGTCTGGATCTTTGTCCTGCTACAACC
CCATGACTAACCAGTGGACCCAGCTGGCTCCGCTCAACAC
ACCCAGAAACCGAGTGGGCGTCGGGGTCATTGATGGGAGC
ATTTATGCTGTTGGGGGTTCACATGCCTCTACGCATCACA
ACAGCGTCGAGAGGTATGACCCAGAAACAAACCGCTGGAC
GTTTGTGGCCCCTATGTCAGTGGCGCGACTGGGGGCCGGT
GTGGCGGCATGTGGAGGTTGCCTGTATGTGGTAGGAGGGT
TTGACGGGGACAACCGGTGGAACACAGTGGAGCGATACCA
ACCAGACACCAACACCTGGCAGCATGTGGCACCTATGAAC
ACAGTGCGCAGCGGGCTGGGGGTGGTGTGTATGGATAACT
ACCTCTATGCAGTTGGAGGCTATGATGGACAAACCCAACT
CAAAACCATGGAGAGATATAACATCACTCGAGATGTGTGG
GAACCCATGGCTTCGATGAACCACTGCCGCAGTGCACATG
GAGTCTCAGTCTACCAGTGCAAGATTTTTGTGTTAGGTGG
ATTTAACCAAGGTGGTTTCCTGTCCAGTGTGGAGTGCTAC
TGTCCCGCCAGTAATGTATGGACGCTTGTAACAGATATGC
CCGTGGGACGCAGTGGAATGGGTGTAGCCGTGACCATGGA
ACCGTGTCCTGGTATCCTGCCAGAGGAGGAGGAAGAAGTG
GACGAGGAGATGTGACATTTCATCGTGTGCCATTTTAAAG
ACAGCACATACTGCAATTCCCTTCAAACTTGATTGTGCAT
GCACGAGATGCCAATGAGGACAAATGTATGTAATTTCAGA
TTGATTTTAAAGTTTATTTGGATCAATCCTCCCTCAGCTA
CAAAGTGTGTGCGATTTAGAGAGAGCAACATGGCTAATCA
CTGGACTAATGAAGTGGTGATCACTGTAGCAGGACTTTAA
ATGAATATCCTGTGACTGACGCACAGACACACGCACAATT
GTTTTGTCGAACTTCTGAATGTGTAATTTTGTGAGCTTGT
TATAAATACTTTTCACATCTGTAAATGCACTGTTTAATGT
GCACACCTGATAAAACACTCAAATCGCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations