header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-7593
Transcript Name: rgs4-202
Previous Name: rgs4-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000024800 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000024800|OTTDARG00000019976|ZDB-GENE-030131-9839 rgs4|OTTDARP00000020438 rgs4-002 LG_ CR385065.21 Danio rerio protein_coding KNOWN, 1348 bp
ATTGAGATTGTGAGGATCTACATTGTGACACTCAGACTTC
TTTTCTCTTGCTTTGGATTTTTATTACGCATCAGCAACAT
GTGTAAAGGGCTTGCTGCTCTTCCTGCAACATGCTTGAAA
AGTGCCAAAGATATAAAACATAAGATTGGCTTCCTGCTTC
AAAAGCCAGATCCACCCCAAGAGCAAAAGACTCTGAAGGA
AAAAGAGAAGGAGAAAGACAAGGAGAAGGTGAAGGACACT
GTGGTCAACAGAATCACTCCTGCCGAAACTGAGAAATGGA
AAACATCATTTACCAACCTGATCAAAAACGACGACGGTCG
CAAGGCTTTCGCATCCTTCCTACAGTCCGAATACAGTCTC
GTCTTAAGACTACATAAGAGGATTTGTGTGCCAGAGCCAA
TTAGACTTCATTTGATGTTTCAGCCATCATGATCGTAAAA
CATTTGCTTTTTAAACCCTTTCAAATCCCCAAAGCTATTA
AAAAATGTGTATCAAATCGCCTCTTGAGTAAGACGTCATC
TTCTATACGGGATTTGTGGAAGCGATGTTTTCACCAGCAA
CATAACCCGCATCTACCCAGTCAAGCTGCATTGAACTGGT
TTTGGGAAAACAACGCCTGACGTAGTTTACAACTAAATGA
CTGTTACAGCTTTGTTCGATGCTATGATGAGAATAGGAAC
ATCATTAACAATAATCAACTGTATCCTCTTTACTCTTGTA
ACGTTATGTAATGCATATATATATTTATATGTGTTTGTAT
AAGCTCTTCTAAGGTGATCGATCACCCAAAAATGAAAATT
TACTCACCATTCTCTCAACCTCAAGTGAGTTTACAACTTC
ATAAAGAGTTTCTTTCTTCTGTTGAAGGCAAAACAACTTT
TTTGAGGAATGCTAGGAAGTCAGAAGTCAATGACAACTAT
AGTTTTCAACATTCTTCAAAATGTCTTATTTTGTGTTCTA
TAGAAGAGAGAAACTATGTGGAAGATGATGACAGTATTTT
CATTTTTGGTTGACTGTCTCTTTTATTCTAAAGGTGAAGT
ACACATTCTTTCTACTCAAAATGTGAACTTGCGTTTTGTT
TTTCTGTTGGCCATCCATCATAATCCACCAAATGACAAGT
GAATGTGATAAATGTGCATGTGCAATGTATACAACCTGTC
ACTAGCAGTAATTCACAAATCGTGCTGTACCTGTATAATG
AAACTGTGTGTTGGCAGATTTAACATATCAAACTACAGAT
GCTCCGGTTCAAATAAATGGCCAAACATGTGAGTTGTTTA
CATATTTGTTTACTATTTCCATATTTATTTTTGTCATATT
TGTGAATAAAATCACACATACTATTTAA

rgs4 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA rgs4-201 (1) 2633
rgs4-202 1348
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
rgs4-202 Contained in:
OTHER rgs4-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000024800 (1)
  • Ensembl_Trans:ENSDART00000133783 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC092675 (1) 1357bp
    GenBank:CN842234 (1) 888bp
    CITATIONS (2)