ZFIN ID: ZDB-TSCRIPT-090929-7592
Transcript Name: rgs4-201
Previous Name: rgs4-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000024799 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000024799|OTTDARG00000019976|ZDB-GENE-030131-9839 rgs4|OTTDARP00000020437 rgs4-001 LG_ CR385065.21 Danio rerio protein_coding KNOWN, 2633 bp
ATTGAGATTGTGAGGATCTACATTGTGACACTCAGACTTC
TTTTCTCTTGCTTTGGATTTTTATTACGCATCAGCAACAT
GTGTAAAGGGCTTGCTGCTCTTCCTGCAACATGCTTGAAA
AGTGCCAAAGATATAAAACATAAGATTGGCTTCCTGCTTC
AAAAGCCAGATCCACCCCAAGAGCAAAAGACTCTGAAGGA
AAAAGAGAAGGAGAAAGACAAGGAGAAGGTGAAGGACACT
GTGGTCAACAGAATCACTCCTGCCGAAACTGAGAAATGGA
AAACATCATTTACCAACCTGATCAAAAACGACGACGGTCG
CAAGGCTTTCGCATCCTTCCTACAGTCCGAATACAGTCAA
GAGAACATTGAATTCTGGGTAGCCTGTGAGGATTTCAAGC
AGACGCCAGCAGACAAGATGAACCTGAAAGCCAGAAATAT
ATTTGAGCGATACATTGAGGCCGATTCCCCCCGTGAGGTC
AATCTGGATTCAGTCACCAGGGAGCAGACCAGAAAGAACC
TGGAAATGTGTGATGTTTCATGTTTTGACGAAGCTCAGAG
TAAAATCTTCACTCTTATGGAAAAAGACTCGTATCGGCGA
TTCCTGAGATCCAGATTGTTCCTGGAACTGTCTCAACCTG
CGATGGACAACAAACCCTGTGGTTTAGAGAAGAAAGTAAA
GCGACAGATTTCTGACTACAGTCAGTGTTTGCCTAGTTAT
GCCTAAACAGAGCCGTCTGCTCCTACATGAACAAAAGTAC
ACTATGAACTGTGGCGTATTGTGACCACCACTCATCGGGC
TGTGTAAAATGAATGACGTTTAATGCGAAACACTGCAGTT
GAATTAGCTACAATTAATAGTTGTCATTATACTTATCCAG
TTGATAAAGTTGACCTTTTTTTTGTTTTAAATTATGTTTG
AACGAGGAAGTACGTATTTTGGATGCGAGGACAAAATTTG
GAAAGTTGGATGATCTTTGACTTTAGATTAGGTTTTTACT
TACATTTTTTATCATTCTATAATTACAAAAATATTGCAAG
CTGCCAAAAATATATTAATTGATTAAATCAAATTATTTTT
TGTGGAATTAAACGGATATGATGAGTCATTTTATGTACGG
TATACAAATCCAAAAAACTTCAGAACATAGTCCTGCATAA
AACTTTAAAGATTGAAGTAAATGGAAATTTATGGCTTAGT
GTGAGAGAATGTTGTAAAGATGGCTTTTAAAAAGCATTTT
GTAATTGAAATCTACAGACACGCAATTATAAAGTGTGTCA
AAAAACAAACCAAAAAGCTTATGGAACTCCTGCTTTAAAT
TTATTCACCTTTAAGAGGTTGCAAACCTTAAAGAGTTTCT
TTTTTTCTGCAGTTTTTTTGAAAAAAGGTAGAAACTGGTG
ACTGTTTATATATAAATACCAAAAGTCAATAGTTACAGGT
TTTCAACATTTTTCAACATAACTTACAAAAGCACAAAAAG
AAACTTAAACAGGTTTGTGACAAGTGCAGGCTTAGAAAAT
GATGACAGATCTTTCTGTTTGGGGTGAAATATCCCTTTGT
CTCATCCATTTTTGGTGTTTTTTTTTACATTAGAATGAAG
AAAAACTTCATGAAAAGCCAAAAAGCCCAATAGCTGCAGT
GTCTCGTCTTAAGACTACATAAGAGGATTTGTGTGCCAGA
GCCAATTAGACTTCATTTGATGTTTCAGCCATCATGATCG
TAAAACATTTGCTTTTTAAACCCTTTCAAATCCCCAAAGC
TATTAAAAAATGTGTATCAAATCGCCTCTTGAGTAAGACG
TCATCTTCTATACGGGATTTGTGGAAGCGATGTTTTCACC
AGCAACATAACCCGCATCTACCCAGTCAAGCTGCATTGAA
CTGGTTTTGGGAAAACAACGCCTGACGTAGTTTACAACTA
AATGACTGTTACAGCTTTGTTCGATGCTATGATGAGAATA
GGAACATCATTAACAATAATCAACTGTATCCTCTTTACTC
TTGTAACGTTATGTAATGCATATATATATTTATATGTGTT
TGTATAAGCTCTTCTAAGGTGATCGATCACCCAAAAATGA
AAATTTACTCACCATTCTCTCAACCTCAAGTGAGTTTACA
ACTTCATAAAGAGTTTCTTTCTTCTGTTGAAGGCAAAACA
ACTTTTTTGAGGAATGCTAGGAAGTCAGAAGTCAATGACA
ACTATAGTTTTCAACATTCTTCAAAATGTCTTATTTTGTG
TTCTATAGAAGAGAGAAACTATGTGGAAGATGATGACAGT
ATTTTCATTTTTGGTTGACTGTCTCTTTTATTCTAAAGGT
GAAGTACACATTCTTTCTACTCAAAATGTGAACTTGCGTT
TTGTTTTTCTGTTGGCCATCCATCATAATCCACCAAATGA
CAAGTGAATGTGATAAATGTGCATGTGCAATGTATACAAC
CTGTCACTAGCAGTAATTCACAAATCGTGCTGTACCTGTA
TAATGAAACTGTGTGTTGGCAGATTTAACATATCAAACTA
CAGATGCTCCGGTTCAAATAAATGGCCAAACATGTGAGTT
GTTTACATATTTGTTTACTATTTCCATATTTATTTTTGTC
ATATTTGTGAATAAAATCACACATACTATTTAA

rgs4 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA rgs4-201 2633
rgs4-202 (1) 1348
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
rgs4-201 Contained in:
OTHER rgs4-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000024799 (1)
  • Ensembl_Trans:ENSDART00000102483 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AY423029 (1) 2642bp
    GenBank:CK679028 (1) 760bp
    GenBank:CK711823 (1) 701bp
    GenBank:BU670721 (1) 671bp
    GenBank:BG737762 (1) 567bp
    GenBank:BG799683 (1) 349bp
    CITATIONS (2)