Transcript

dctn2-202

ID
ZDB-TSCRIPT-090929-7541
Name
dctn2-202
Previous Names
  • dctn2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000024730 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000024730|OTTDARG00000019944|ZDB-GENE-040426-1279 dctn2|OTTDARP00000020392 dctn2-001 LG_ BX950854.12 Danio rerio protein_coding KNOWN, 2035 bp
GTGCGAGATTTTGTTTTTGAATGACGTCACATCTGTCATT
GTGGAAGCAGGCGGCCTGTGTCAGCGTCATCCGCTTCATC
CAGCGTTTATATCTCATTTATATCTACAGTAAAGCAACTT
ATTAATAGGTATTTATATTAAATTACTTGTCTCCAGCGTG
CTGCAACAATGGCCGACCCGAAGTACGCGAACCTGCCGGG
CATCGCCTCCAACGAGCCTGATGTTTACGAGACGAGTGAC
CTGCCGGAGGATGATCAGGCGCAGTTTGAGTCTGAGCTGG
AGGAGCTGTGCAGTGACAGTGTGGAGCGCATCGTCGTCAA
TCCCAACGCCGCATATGACAAGTTTAAAGACAAACACGTC
AGCGCTAAAGGTTTGGATTTCTCAGACCGCATCAGTAAGA
ATCGGCGAGTGGGCTATGAGTCTGGAGACTATGAGCTGTT
AGCTGAAGGCTGCGGCGTAAAGGAAACTCCTCAGCAGAAA
TATCAGCGGCTGGTTAATGAGATCCACGAGCTCTGCCAGG
ATGTGGAGAAAATTCAGACGAGCACTAAAGAGAGCGGTGC
GGAGGAGCGTTTGACGCCGGTGGCTCTGGCTCAGCAGGCG
GCGCAGCTCAAACAGCAGCTGGTTTCAGCTCATCTGGACT
CTCTGCTCGGACCCGACGCCCACATCAACCTCACCGACCC
TGATGGAGCGCTCGCCAAGCGGTTGCTGACGCAGCTGGAG
GTGGCGCGGGGCGTCCGGAGCGGAGCGGGTGCGGATGGGA
AAACCGCAGCACCCAAAGGCCCAGACGGAGTGATTCTCTA
TGAGCTCCACAGTCGACCCGAGCAGGAGAAGTTCACTGAA
TCTGCAAAGGTAGCAGAGCTGGAGAGACGTCTAGCAGAGC
TGGAGACTGCGGTGGGGTCTGGGTCAGACAAACGGGGGCC
GCTCAGCTCCGGGGTTCAGGGCTCCAGTCTGACGGAGACT
TTAGAGCTGCTGCAGGCGCGGGTCAGTGCTCTGGACGCTG
CTACACTGGACCAGGTGGAGGCCAGACTACAGAGTGTTTT
GGGGAAGATGAATGAAATTGCCAAACACAAGGCGACGATG
GAGGACGCAGAGACTCAGAGTAAACTGTATGATGTGGTGC
AGAAGTGGGATGCGATGGCCACTTCTCTCCCGCAGGTGGT
GCAGAGACTGACTGCGGTCCGAGAGCTGCATGAGCAGGCG
ATGCAGTTTGGGCAGCTCCTGACTCACCTGGACACGACGC
AGCAGATGATCAACAACTCACTGAAGGACAACAGCACACT
CCTGACACAGGTCCAGCAGACCATGAAGGAGAACCTGCTG
GCCGTGGAGGAAAACTTCTCAGCGCTGGACCAGAGGATGA
AGAAACTCAACAAGTAGATGCTTCCCGTCCACAAAAGCAG
ACCAAGGTGGAGACCAAACCACAGCTTCACCCTTTATCAT
TCACACAGACTCTGAAACTCACAAACGTCTGAATCTGAAC
ATAATGAAGACCCGAAGAGAGTTTTCCCGCACCTCCATCG
TGCATTGTGTAAATATAGAGGCGCACACTGCAGGACACAG
GCTTTCCACTCAGTGTGCATCTCGATTCTAGTCTGAATAT
CTAAACACTCTTAAATCAAGAAGCGTTTTTCAGACTAGTA
ACAATTATAATCTTGTTTTCAGCAGTATTGAGGTGAGTTT
GTTCTAAATAATCTGCCTATGGTGTTCGAAAAATAATGTT
TATTCTGTAAAATAAGATTATTCCACTCCATTGGTGGATT
ATTGTGCTTGTTTTAAGGACAAACTCACTTCATTATTGCT
GAAAACAACACAGAAAATGCTTCTTAATTCAAGAGTTTGT
TGCTATATGGACTGCAAACAGGACACAAACTCTGAGTAAA
GGCTCTTTGCAGTGTGTTGTGCTGATCTTGTTCTCATGAG
AGATTGCTTGTAACCGTTATTGTATTATTAATGTGGTGTT
CAGTCCACAAATGATGACCAGTTTCAATATAGAATTTCAC
ATGCTTCTCTGGATAATAAACAGCTTCCAGAATGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations