header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-7535
Transcript Name: rpl3-202
Previous Name: rpl3-003

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000024722 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000024722|OTTDARG00000019941|ZDB-GENE-030131-1291 rpl3|OTTDARP00000020386 rpl3-003 LG_ BX901883.5 Danio rerio protein_coding KNOWN, 738 bp
GACTTTTCCTCCATGAAGAAGTACTGCCAGATCATTCGCA
TCATTGCCCACACTCAGATGCGCCTGCTGCCCCACAGACA
GAAGAAGTCTCACTTGATGGAGATCCAGCTGAACGGAGGC
ACCATCTCCGATAAGGTTGACTGGGCCAGAGAGAAGCTTG
AGCAGTCCATTCCCATCGCTAATGTCTTCTCTCAGGATGA
GATGATTGACGTTATTGGTGTTACCAAGGGACATGGATGC
AAGGGTGTGACTAGCCGTTGGCACACAAAGAAGCTGCCCC
GCAAGACCCATCGTGGTCTGCGTAAGGTGGCTTGTATTGG
AGCCTGGCATCCTGCCCGTGTGGCTTTCTCTGTGGCTCGT
GCTGGACAGAAGGGCTACCACCACCGCACAGAAATCAACA
AAAAGATCTACAAGATTGGTGTGGGCTATCATAACAAGGA
CGGAAAACTTGTCAAGAACAACGCCTCTACTGATTATGAT
CTGTCCAACAAGAGCATCAACCCTCTGGTGAGTGTGCTGT
TGTCTCCCTATTGTGAATTTGATAAATTGTTTATATGCAT
GCATTAATACTGATGCCTTTTTATTTTAGGGTGGCTTTGT
GCATTATGGTGAGGTGACGAATGACTTCCTCATGCTGAAA
GGCTGTGTGGTCGGAACCAAGAAGAGGGTTTTGACTCTGC
GCAAATCTCTACTGGTCCAGACCAGCCGTCGTGCTCAGGA
GAAGATCGACCTGAAGTT

rpl3 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA rpl3-002 (1) 801
mRNA rpl3-201 (1) 1382
rpl3-202 738
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
rpl3-202 Contained in:

OTHER rpl3-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000024722 (1)
  • Ensembl_Trans:ENSDART00000138327 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CT625976 (1) 739bp
    CITATIONS (2)