Transcript

nanos3-201

ID
ZDB-TSCRIPT-090929-7517
Name
nanos3-201
Previous Names
  • nanos-001
  • nanos3-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000024703 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000024703|OTTDARG00000019934|ZDB-GENE-011221-1 nanos3|OTTDARP00000020373 nanos3-001 LG_ BX284640.7 Danio rerio protein_coding KNOWN, 1127 bp
TTGTTTTGATCGCGCGCTCGGAGAGCAACATGGCTTTTTC
TCTTCTCCAATTCATCCTTTCTGCTCATGGATCTATGGAG
ACTAGAAACCAGGACTTTCAGCCTTGGAAGGACTACATGG
GTTTGGCGGACATGATCAGAGGCATGAAGCGGCAAGAAAT
GCAATCTGACGCGGATTCAGACGAACAGGCTGCCGCGCTG
CTGGAGTCTCCAAGCGGCCCGATTCGGTCGCGCGACTCAC
CGGAGCAGAACACGAGCCCGGGGGGCGGTAAACCCAAGAG
CAGCCCAGCAGAGAGAAAGTTCTGCAGCTTCTGCAAACAC
AACGGCGAGACTGAGGCCGTGTACACCTCTCACTACTTAA
AAAACCGCGATGGAGACGTGATGTGCCCGTATCTCCGACA
GTACAAGTGTCCCCTGTGTGGGGCCACCGGGGCCAAAGCG
CACACCAAGAGATTCTGCCCGATGGTGGACAAGAACTACT
GCTCGGTGTACGCCAAATCAACATGGTGAAGCGGACATTG
ATGCTCCGGTAGATTTGAAGAAACACTTTTTACCGCAGGT
TTTAATGTTTAAGTTTTAACTCTTTAATTGTTTGTTTGGT
TGATACGCGGCGGATTGCGAGTTTGCATGCATGTGTGCGT
TCACTGTTTGATTTTGCACTTTTTTTGTGTGTGTGTATAT
GTGTGTGTTTGCTGTGTTTTATTTTGTGTGCACTGGTGTT
GTGTTTTCACTTGGTAACAAACTTGTACACAAGCCAGCAG
GCTCGCTACAGGCGCAACCGCACTCAAAAACAAACCCTTT
CATGCTTATTTGGTAAATACAATGTGTGTTTAGTCCTCCT
TTTAAATGTCAGATTTTATGGTGTTGTATTTAAACAAAAA
ATTCAATGTTAATATTTAGATTTTAGTGATTTTATTATTG
AAAACGGCTTGTTTTGTATAAGTAACCTTTAAAAAAAGTT
TTCTCCATTGCATTTAAATTCAGTTTGAAAAACATAATCG
CCATATTTTCATGTCGCTTGCTAAAATTCATGTACTACTT
TCATCATTTTATGTCAGTGTGTGATTTTTGACTTGTGATG
GAGTGAAAAATGTGAGGAAAATATAAACATTTTCTCTAGA
CTTTAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations