Transcript

emc3-002

ID
ZDB-TSCRIPT-090929-7469
Name
emc3-002
Previous Names
  • pob-002
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000024650 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000024650|OTTDARG00000019903|ZDB-GENE-040426-2904 emc3|no_translation pob-002 LG_ BX957236.8 Danio rerio protein_coding KNOWN, 527 bp
CTATGGTGTCGCATCCTGATTCGAGTCGTTATCGGTCTTC
TCACAGATAAACCGTCATTTGAATACGAGAGCAGGGTGGT
GAAATTCCATCAGCATCTCTTCCTAAAAAGCATGGCTGAG
CCCGAGCTCCTCCTGGACTCCAACATCCGTCTTTGGGTTG
TGCTGCCAATTGTATTTATTACTTTTCTCGTTGGTGTGAT
CCGCCATTATGTCTCAATTCTGTTACAAAGTGATAAGAAG
CTTACATTAGAGCAGGTTTCAGACAGGTAACATTTATCGT
CCGTCTACTTTTATTTCTAAAACACACAAAATATTTCAAA
CTATTTTTGAATGTCCTCCACACAGCCAGGTTCTTATCAG
GAGCAGAGTTTTACGAGAAAATGGCAAATACATCCCTAAA
CAATCTTTCTTGATGAGAAAATTCTACTTCAATAACCAAG
AAGATGGGTTTTTTAAGAAGACTAAGAGAAAGGTGGTCCC
ACCGTCTCCGATGACTGATCCGAGCATGTTGACCGATATG
ATGAAAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations